KLC1 (NM_001130107) Human 3' UTR Clone

CAT#: SC204921

3' UTR clone of kinesin light chain 1 (KLC1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KLC1 (NM_001130107) Human 3' UTR Clone
Vector pMirTarget
Synonyms KLC; KNS2; KNS2A
ACCN NM_001130107
Insert Size 371 bp
Sequence Data
>SC204921 3’UTR clone of NM_001130107
The sequence shown below is from the reference sequence of NM_001130107. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGGCCTGGAAGACGCCACCGCTAACTGACCCCGACCTGGCCCCGCTCCAGGATGGGACTGCCGAGTG
TGGCCCGGAGCTGGCCCGGGACAGCCAGGGCGGCAGGGAGGGCCCCTGGCCGGGAGCCGCAGCGCTCAC
TCATTTCTCCTGCGTCTGTGTGCATAGGACATGATACTAATAACCACACGGCTGGCGTGACCTTGGGGC
TGGGGCTGGGCCTAAGCTGGTGCCCTGGTGCGGCGTGGTCTCTCCCAGGAGACCTGGGGCATGAGCTGG
GCCCACGGCTCCCTTCCCATGTGTAACTTCCTCACGTTGTGTGCGATAACGTATTTTATTGTACATTTT
TTTAAATTAAAAGTTTATATGCCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130107.2
Synonyms KLC; KNS2; KNS2A
Summary Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature and/or biological validity of most of these variants have not been determined. [provided by RefSeq, Jul 2008]
Locus ID 3831
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...