Superoxide Dismutase 1 (SOD1) (NM_000454) Human 3' UTR Clone

CAT#: SC204961

3' UTR clone of superoxide dismutase 1 soluble (SOD1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Superoxide Dismutase 1 (SOD1) (NM_000454) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD; STAHP
ACCN NM_000454
Insert Size 383 bp
Sequence Data
>SC204961 3’UTR clone of NM_000454
The sequence shown below is from the reference sequence of NM_000454. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCTGAGGCCCCTTAACTCATC
TGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGTAATTG
TGTGACTTTTTCAGAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTTGGAAGATTT
GTATAGTTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCAGACTTAAATCACA
GATGGGTATTAAACTTGTCAGAATTTCTTTGTCATTCAAGCCTGTGAATAAAAACCCTGTATGGCACTT
ATTATGAGGCTATTAAAAGAATCCAAATTCAAACTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000454.5
Synonyms ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD; STAHP
Summary The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. In addition, this protein contains an antimicrobial peptide that displays antibacterial, antifungal, and anti-MRSA activity against E. coli, E. faecalis, S. aureus, S. aureus MRSA LPV+, S. agalactiae, and yeast C. krusei. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2020]
Locus ID 6647
MW 14.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...