MRP4 (ABCC4) (NM_001105515) Human 3' UTR Clone

CAT#: SC205083

3' UTR clone of ATP-binding cassette sub-family C (CFTR/MRP) member 4 (ABCC4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MRP4 (ABCC4) (NM_001105515) Human 3' UTR Clone
Vector pMirTarget
Synonyms MOAT-B; MOATB; MRP4
ACCN NM_001105515
Insert Size 394 bp
Sequence Data
>SC205083 3’UTR clone of NM_001105515
The sequence shown below is from the reference sequence of NM_001105515. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGTTGTCCTGGCTGGTCTCAAACTCCTAGGCTCAAGCAATCCTCCTCCCTCCTCAAGCAAACCTCAGT
GCTGGGATTATAGGCATGAGCCACTGTACCTGGCTAAATGTTGTTTTTTTGATATTCAATTTTTGTTTA
TAGAATTTTCATTTGTTTTGCTCTTATACTTTTCATCTTTTTATGTTTATTGACCAATTAAATATCATT
TGGGTAAGCACCTATTTAAGTGTCTTAACAATTTTTCTATTGAGTACTCTGGGTTTTTGTTTTGTTTTT
CTTACTGATTTGTAGAATTCTTTATGTATTCTGAATTGCAGATACCTTCCTTCTGTACTAATGCTTATC
TTTTTAGCCCTGTAATATTGTGTTTTCATAAACATACTTATCAATCTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001105515.3
Synonyms MOAT-B; MOATB; MRP4
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Locus ID 10257
MW 15
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...