Nebulin (NEB) (NM_001164508) Human 3' UTR Clone

CAT#: SC205679

3' UTR clone of nebulin (NEB) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Nebulin (NEB) (NM_001164508) Human 3' UTR Clone
Vector pMirTarget
Synonyms AMC6; NEB177D; NEM2
ACCN NM_001164508
Insert Size 451 bp
Sequence Data
>SC205679 3’UTR clone of NM_001164508
The sequence shown below is from the reference sequence of NM_001164508. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCCCAGCCAACTACGTTGAAGCTATTTAGGCATTTCAAAGCATCACACTTGTCTGCAGGACTTACAGA
TCCTGCAGTCAATGTTTCGGTTTAGACTCTCCACTGTTACCTAAGTTCTCAAGCTGCCTATGGTTTTTC
TGTGTCAATGTGATTTATGGTAGTACCATCCTTTCTCCTTTGGGTTTTAAAATAAGTTGCAGAACAGAC
ACTTTAAAAGCTTCTGCAATATTATTTCTGTGCCTAGAGTCTTTCTCCATTATAAACATGTTTTAACAT
TATTTCTTTTCTAAAACAGGGATTTTGAATATGCCAAACACATTAAAGGAAAAATAGCAGAGATGTTCA
CCTTTTCCTTGCTGATTGCTAATGCTTATTATTTCTAATTCAGTTCTGAAGTTATAAACTTATAATCAA
TACAAACCAGCAACTAATAAAACCTCTAATTCTGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164508.2
Synonyms AMC6; NEB177D; NEM2
Summary This gene encodes nebulin, a giant protein component of the cytoskeletal matrix that coexists with the thick and thin filaments within the sarcomeres of skeletal muscle. In most vertebrates, nebulin accounts for 3 to 4% of the total myofibrillar protein. The encoded protein contains approximately 30-amino acid long modules that can be classified into 7 types and other repeated modules. Protein isoform sizes vary from 600 to 800 kD due to alternative splicing that is tissue-, species-,and developmental stage-specific. Of the 183 exons in the nebulin gene, at least 43 are alternatively spliced, although exons 143 and 144 are not found in the same transcript. Of the several thousand transcript variants predicted for nebulin, the RefSeq Project has decided to create three representative RefSeq records. Mutations in this gene are associated with recessive nemaline myopathy. [provided by RefSeq, Sep 2009]
Locus ID 4703
MW 16.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...