RHOC (NM_001042678) Human 3' UTR Clone

CAT#: SC205821

3' UTR clone of ras homolog gene family member C (RHOC) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5,464.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RHOC (NM_001042678) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARH9; ARHC; H9; RHOH9
ACCN NM_001042678
Insert Size 454 bp
Sequence Data
>SC205821 3' UTR clone of NM_001042678
The sequence shown below is from the reference sequence of NM_001042678. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGTCCGCAAGAACAAGCGTCGGAGGGGCTGTCCCATTCTCTGAGATCCCCAAGGCCTTTCCTACATGCC
CCCTCCCTTCACAGGGGTACAGAAATTATCCCCCTACAACCCCAGCCTCCTGAGGGCTCCATGCTGAAGG
CTCCCATTTTCAGTTCCCTCCTGCCCAGGACTGCATTGTTTTCTAGCCCCGAGGTGGTGGCACGGGCCCT
CCCTCCCAGCGCTCTGGGAGCCACGCCTATGCCCTGCCCTTCCTCAGGGCCCCTGGGGATCTTGCCCCCT
TTGACCTTCCCCAAAGGATGGTCACACACCAGCACTTTATACACTTCTGGCTCACAGGAAAGTGTCTGCA
GTAGGGGACCCAGAGTCCCAGGCCCCTGGAGTTGTTTTCGGCAGGGGCCTTGTCTCTCACTGCATTTGGT
CAGGGGGGCATGAATAAAGGCTACAGGCTCCAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042678.1
Synonyms ARH9; ARHC; H9; RHOH9
Summary This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The protein encoded by this gene is prenylated at its C-terminus, and localizes to the cytoplasm and plasma membrane. It is thought to be important in cell locomotion. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Locus ID 389
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...