HLAB (HLA-B) (NM_005514) Human 3' UTR Clone

CAT#: SC205869

3' UTR clone of major histocompatibility complex class I B (HLA-B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLAB (HLA-B) (NM_005514) Human 3' UTR Clone
Vector pMirTarget
Synonyms AS; B-4901; HLAB
ACCN NM_005514
Insert Size 456 bp
Sequence Data
>SC205869 3’UTR clone of NM_005514
The sequence shown below is from the reference sequence of NM_005514. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGGCTCTGATGTGTCTCTCACAGCTTGAAAAGCCTGAGACAGCTGTCTTGTGAGGGACTGAGATGCA
GGATTTCTTCACGCCTCCCCTTTGTGACTTCAAGAGCCTCTGGCATCTCTTTCTGCAAAGGCACCTGAA
TGTGTCTGCGTCCCTGTTAGCATAATGTGAGGAGGTGGAGAGACAGCCCACCCTTGTGTCCACTGTGAC
CCCTGTTCCCATGCTGACCTGTGTTTCCTCCCCAGTCATCTTTCTTGTTCCAGAGAGGTGGGGCTGGAT
GTCTCCATCTCTGTCTCAACTTTACGTGCACTGAGCTGCAACTTCTTACTTCCCTACTGAAAATAAGAA
TCTGAATATAAATTTGTTTTCTCAAATATTTGCTATGAGAGGTTGATGGATTAATTAAATAAGTCAATT
CCTGGAATTTGAGAGAGCAAATAAAGACCTGAGAACCTTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005514.8
Synonyms AS; B-4901; HLAB
Summary HLA-B belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exon 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-B alleles have been described. [provided by RefSeq, Jul 2008]
Locus ID 3106
MW 16.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...