KCNS3 (NM_002252) Human 3' UTR Clone

CAT#: SC206583

3' UTR clone of potassium voltage-gated channel delayed-rectifier subfamily S member 3 (KCNS3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KCNS3 (NM_002252) Human 3' UTR Clone
Vector pMirTarget
Synonyms KV9.3
ACCN NM_002252
Insert Size 504 bp
Sequence Data
>SC206583 3’UTR clone of NM_002252
The sequence shown below is from the reference sequence of NM_002252. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCTCCTTGGAGAATTGCACAGCAAAATGAGCGGGGGTGTTTGTGCCTGTTTCTCTTATCCTTTCCCGA
CATTAGGTTAACACAGCTTTATAAACCTCAGTGGGTTCGTTAAAATCATTTAATTCTCAGGGTGTACCT
TTCAGCCATAGTTGGACATTCATTGCTGAATTCTGAAATGATAGAATTGTCTTTATTTTTCTCTGTGAG
GTCAATTAAATGCCTTGTTCTGAAATTTATTTTTTACAAGAGAGAGTTGTGATATAGTTTGGAATATAA
GATAAATGGTATTGGGTGGGGTTTGTGGCTACAGCTTATGCATCATTCTGTGTTTGTCATTTACTCACA
TTGAGCTAACTTTAAATTACTGACAAGTAGAATCAAAGGTGCAGCTGACTGAGACGACATGCATGTAAG
ATCCACAAAATGAGACAATGCATGTAAATCCATGCTCATGTTCTAAACATGGAAACTAGGAGCCTAATA
AACTTCCTAATTCAGTATGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002252.5
Synonyms KV9.3
Summary Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Locus ID 3790
MW 19.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...