KIR2DL2 (NM_014219) Human 3' UTR Clone

CAT#: SC206887

3' UTR clone of killer cell immunoglobulin-like receptor two domains long cytoplasmic tail 2 (KIR2DL2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KIR2DL2 (NM_014219) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD158b; CD158B1; NKAT-6; NKAT6; p58.2
ACCN NM_014219
Insert Size 541 bp
Sequence Data
>SC206887 3’UTR clone of NM_014219
The sequence shown below is from the reference sequence of NM_014219. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGCGTCTTCTAGGGAGAC
AACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATGAGTC
TGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCACTTGCTTACAAATGTC
TAAGGTCCCCACTGCCTGCTGGAGAAAAAACACACTCCTTTGCTTAGCCCACAGTTCTCCATTTCACTT
GACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAG
GAACTCACAATTCCAAACATACAAGAGGCTCCCTCTTAACGCAGCACTTAGACACGTGTTGTTCCACCT
TCCCTCATGCTGTTCCACCTCCCCTCAGACTAGCTTTCAGTCTTCTGTCAGCAGTAAAACTTATATATT
TTTTAAAATAACTTCAATGTAGTTTTCCATCCTTCAAATAAACATGTCTGCCCCCATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014219.2
Synonyms CD158b; CD158B1; NKAT-6; NKAT6; p58.2
Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
Locus ID 3803
MW 19.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...