Khdrbs1 (NM_011317) Mouse Untagged Clone
CAT#: MC200069
Khdrbs1 (untagged) - Mouse KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1), (10ug)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | p62; p68; Sam68 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002051 sequence for NM_011317
GCTGTCGCTCCTGTTCTTCCACCCCCGCCAACCGCCGCTCGGGCCTCAGCTGCCGCCGCGTCGCTTCCTC GCTCGTTCGCTCGCCACCCATCATCCCCGATGCAGCGCCGGGACGATCCTGCCTCGCGCCTCACCCGGTC CTCGGGCCGCAGCTGCTCCAAGGACCCGTCAGGTGCCCACCCCTCGGTGCGTCTGACCCCGTCTCGGCCG TCGCCGCTTCCTCACCGGCCCCGGGGAGGGGGAGGTGGGCCCAGAGGAGGCGCTCGGGCCTCGCCCGCCA CGCAGCCGCCGCCGCTGCTGCCTCCCTCCACCCCGGGTCCCGACGCGACGGTGGTGGGTTCCGCGCCGAC CCCGCTGCTGCCCCCGTCAGCCACAGCCGCGGTCAAGATGGAGCCGGAGAATAAGTACCTGCCTGAACTC ATGGCCGAGAAGGACTCGCTCGACCCGTCCTTCACTCACGCCATGCAGCTGCTGTCCGTAGAAATTGAGA AGATTCAGAAGGGAGAGTCAAAAAAAGATGACGAGGAGAATTATTTGGATTTATTTTCTCATAAGAACAT GAAGCTGAAAGAACGCGTGCTGATACCTGTCAAGCAGTATCCAAAGTTCAATTTTGTGGGGAAGATTCTT GGACCACAAGGAAATACAATCAAAAGACTCCAGGAAGAGACTGGTGCAAAGATCTCTGTCTTGGGGAAGG GTTCAATGAGAGACAAAGCCAAGGAGGAAGAGTTGCGCAAGGGTGGAGACCCCAAATATGCCCATTTAAA TATGGATCTGCATGTCTTCATTGAAGTCTTTGGACCCCCGTGTGAAGCTTATGCTCTTATGGCCCATGCT ATGGAAGAAGTCAAGAAGTTCCTAGTACCAGATATGATGGATGATATCTGTCAGGAGCAGTTTCTAGAAT TGTCCTACTTGAACGGAGTACCTGAACCCTCTCGTGGTCGTGGGGTATCTGTGAGAGGACGAGGAGCTGC CCCTCCTCCTCCACCTGTTCCCAGAGGACGTGGTGTTGGACCACCTAGAGGAGCTTTGGTTCGTGGAACC CCAGTGAGAGGCTCCATCACCAGAGGTGCCACTGTGACTCGAGGAGTGCCACCCCCACCTACTGTGAGGG GTGCTCCAACACCAAGAGCTCGGACAGCTGGGATTCAGAGAATACCTTTGCCTCCCACACCTGCACCAGA AACATACGAAGATTATGGATATGATGATACATACGCAGAACAGAGTTACGAAGGCTATGAAGGCTATTAC AGCCAGAGTCAAGGGGAGTCAGAGTATTATGACTATGGACATGGGGAGCTCCAAGATTCTTACGAAGCCT ACGGACAAGATGACTGGAATGGGACCAGGCCATCACTGAAGGCTCCTCCAGCTAGGCCAGTGAAGGGAGC ATACAGAGAGCATCCATATGGACGTTATTAAAAACAAACAGGAGGGAAAAATATCAGTTATGAGCAAAGT TGTTACTGATTTCTTGTATCCCAGGATTCCTGTTGCTTTACCCACAACAGACAAGTAATTGTCTAAGTGT TTTTCTTCGTGGTCCCTTTCTTTTCCCCACTTCCTCCATTCTTAACTCTGCATTCTGGCTTCTGTATGTA GTATTTTAAAATGAGTTAAAATAGATTTAGGAATATCGAATTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011317 |
Insert Size | 1332 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002051, AAH02051 |
RefSeq Size | 1667 bp |
RefSeq ORF | 1332 bp |
Locus ID | 20218 |
UniProt ID | Q60749 |
Gene Summary | Recruited and tyrosine phosphorylated by several receptor systems, for example the T-cell, leptin and insulin receptors. Once phosphorylated, functions as an adapter protein in signal transduction cascades by binding to SH2 and SH3 domain-containing proteins. Role in G2-M progression in the cell cycle. Represses CBP-dependent transcriptional activation apparently by competing with other nuclear factors for binding to CBP. Also acts as a putative regulator of mRNA stability and/or translation rates and mediates mRNA nuclear export. Positively regulates the association of constitutive transport element (CTE)-containing mRNA with large polyribosomes and translation initiation. May not be involved in the nucleocytoplasmic export of unspliced (CTE)-containing RNA species. RNA-binding protein that plays a role in the regulation of alternative splicing and influences mRNA splice site selection and exon inclusion. Binds to RNA containing 5'-[AU]UAA-3' as a bipartite motif spaced by more than 15 nucleotides. Binds poly(A). In cooperation with HNRNPA1 modulates alternative splicing of BCL2L1 by promoting splicing toward isoform Bcl-X(S), and of SMN1 (By similarity). Can regulate CD44 alternative splicing in a Ras pathway-dependent manner. Can regulate alternative splicing of NRXN1 and NRXN3 in the laminin G-like domain 6 containing the evolutionary conserved neurexin alternative spliced segment 4 (AS4) involved in neurexin selective targeting to postsynaptic partners. In a neuronal activity-dependent manner cooperates synergistically with KHDRBS2/SLIM-1 in regulation of NRXN1 exon skipping at AS4. The cooperation with KHDRBS2/SLIM-1 is antagonistic for regulation of NXRN3 alternative splicing at AS4 (PubMed:12478298, PubMed:22196734, PubMed:24469635).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG207062 | Khdrbs1 (tGFP-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1) |
CNY 4,280.00 |
|
MR207062 | Khdrbs1 (Myc-DDK-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1) |
CNY 3,656.00 |
|
MR207062L3 | Lenti ORF clone of Khdrbs1 (Myc-DDK-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1) |
CNY 5,800.00 |
|
MR207062L4 | Lenti ORF clone of Khdrbs1 (mGFP-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1) |
CNY 5,800.00 |
其它Khdrbs1产品