Ube2k (NM_016786) Mouse Untagged Clone

CAT#: MC200177

Ube2k (untagged) - Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k), (10ug)



  "NM_016786" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW492011; D5Ertd601e; E2-25k; HIP-2; Hip2; Hypg; Lig
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002013 sequence for NM_016786
GAGGTGGCAGCGGTGGCGGTGGTCGTAGCGGTGGCGGAGGAGGCGGGTACGAATCAGCTGCGGGCAGAGA CATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGC AAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTC CAGACACACCGTATGAAGGTGGAAGATATCAACTAGAGATAAAAATACCAGAAACATATCCATTTAACCC CCCTAAGGTCCGGTTTATCACTAAAATATGGCACCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTG GATATCCTGAAAGATCAATGGGCAGCAGCAATGACTCTGCGCACGGTATTATTGTCATTGCAAGCGCTGT TGGCGGCTGCAGAACCAGATGACCCCCAAGATGCAGTAGTAGCGAATCAGTACAAACAGAATCCTGAAAT GTTCAAGCAGACAGCTCGACTTTGGGCACACGTGTACGCTGGAGCACCAGTTTCTAGTCCAGAATACACC AAAAAAATAGAAAACCTCTGTGCTATGGGTTTTGATAGGAACGCAGTAATAGTGGCCTTGTCTTCAAAAT CATGGGATGTAGAGACTGCAACAGAACTGCTTCTGAGTAACTGAGGCACAGGAGCTGCGCCAGCATCGCT CTCGCCTCTTGAGGAGCATCAACACCTGTTATTTTTAGGATTCTGCATAAAGTTCTTTTAAACTGGCATT CTTGCCTAATGATGTTACCTAGGCACCATTGGAGACTGCAAAAAAAAAAAAATTCCCTGCTCTGTAAATA AAGCTAATTAAACGTCTGTGTAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_016786
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002013, AAH02013
RefSeq Size 894 bp
RefSeq ORF 603 bp
Locus ID 53323
UniProt ID P61087
Gene Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro, in the presence or in the absence of BRCA1-BARD1 E3 ubiquitin-protein ligase complex, catalyzes the synthesis of 'Lys-48'-linked polyubiquitin chains. Does not transfer ubiquitin directly to but elongates monoubiquitinated substrate protein. Mediates the selective degradation of short-lived and abnormal proteins, such as the endoplasmic reticulum-associated degradation (ERAD) of misfolded lumenal proteins. Ubiquitinates huntingtin. May mediate foam cell formation by the suppression of apoptosis of lipid-bearing macrophages through ubiquitination and subsequence degradation of p53/TP53. Proposed to be involved in ubiquitination and proteolytic processing of NF-kappa-B; in vitro supports ubiquitination of NFKB1. Involved in stabilization of CASP12 during ER stress-mediated amyloid-beta neurotoxicity probably by inhibiting proteasome activity; in vitro ubiquitinates CASP12.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...