Dctpp1 (NM_023203) Mouse Untagged Clone
CAT#: MC200235
Dctpp1 (untagged) - Mouse dCTP pyrophosphatase 1 (Dctpp1), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410015N17Rik; AI854235; RS21-C6 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC004623 sequence for NM_023203
GTCAGAACTCTGGAGGCGGCTCCGAGCGCGGCGCGGGGTCCGCTCCCGCGCGGGTTGGACTAGTGGGCGG AATGTCCACGGCTGGTGACGGTGAGCGCGGTACTGTGGGACAAGAAGACTCTGCTGCTGCCCGCCCGTTC AGATTCAGTCCGGAGCCCACGCTTGAGGACATCCGACGCCTCCATGCAGAGTTTGCAGCTGAGCGGGACT GGGAGCAGTTCCACCAGCCTCGGAACCTGCTGCTAGCCTTGGTGGGAGAAGTGGGCGAGCTGGCAGAACT CTTCCAGTGGAAGTCTGATACAGAGCCTGGTCCTCAAGCATGGCCACCAAAGGAGAGAGCAGCCCTTCAG GAGGAGCTTAGCGACGTCCTCATCTACCTGGTAGCATTAGCAGCCCGCTGCCATGTGGATTTACCTCAAG CAGTAATCTCCAAAATGGACACCAACCGCCAACGTTACCCAGTCCACCTGTCCCGAGGTTCTGCCTGCAA GTACACTGACTTGCCCCGTGGGACCATCTCTGAAAACCAGGCTGTGGGGGCTGGAGACCCTGCCTCGGAG CTGAGAGACCAGGCTTCCACATAAAAACGAGGTGCTAATCTGGCCTTATTAAGTCTGGGCCCAAGTGTTT TCTCTCTCAATAAAATGACTTAAGGCAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_023203 |
Insert Size | 513 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC004623, AAH04623 |
RefSeq Size | 681 bp |
RefSeq ORF | 513 bp |
Locus ID | 66422 |
UniProt ID | Q9QY93 |
Gene Summary | Hydrolyzes deoxynucleoside triphosphates (dNTPs) to the corresponding nucleoside monophosphates. Has a strong preference for dCTP and its analogs including 5-iodo-dCTP and 5-methyl-dCTP for which it may even have a higher efficiency. May protect DNA or RNA against the incorporation of these genotoxic nucleotide analogs through their catabolism.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201423 | Dctpp1 (tGFP-tagged) - Mouse RIKEN cDNA 2410015N17 gene (2410015N17Rik) |
CNY 2,850.00 |
|
MR201423 | Dctpp1 (Myc-DDK-tagged) - Mouse dCTP pyrophosphatase 1 (Dctpp1) |
CNY 2,400.00 |
|
MR201423L3 | Lenti ORF clone of Dctpp1 (Myc-DDK-tagged) - Mouse dCTP pyrophosphatase 1 (Dctpp1) |
CNY 4,750.00 |
|
MR201423L4 | Lenti ORF clone of Dctpp1 (mGFP-tagged) - Mouse dCTP pyrophosphatase 1 (Dctpp1) |
CNY 4,750.00 |