United States
Germany
Japan
United Kingdom
China
Polr2g (NM_026329) Mouse Untagged Clone
CAT＃: MC200405
Polr2g (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2410046K11Rik; A230108L04Rik; C76415; RBP7; Rpo2-7l |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC005580 sequence for NM_026329
GCGCTGCGGAAGCGACCGCAGAGAAGTGGTGGGACTTCTGCAAGTGCTTCCGGAGAGGTCTCTGCGTGGG AAGTTCTGGGCGCTGCGGGCCAAGCTTCTGCAGAAGATGTTTTATCACATTTCCCTGGAGCACGAGATCC TCCTGCACCCACGATACTTCGGTCCAAACTTGCTCAACACGGTGAAGCAGAAGCTGTTTACCGAGGTGGA GGGGACCTGCACTGGGAAATATGGCTTTGTAATTGCTGTCACCACCATCGACAATATTGGTGCTGGTGTG ATCCAGCCAGGCCGAGGTTTTGTTCTTTATCCAGTGAAATACAAAGCTATTGTTTTCCGGCCCTTTAAAG GTGAAGTGGTGGATGCTGTGGTCACTCAGGTCAACAAGGTTGGACTTTTCACAGAAATTGGGCCTATGTC TTGCTTCATCTCTCGACATTCCATCCCTTCAGAGATGGAGTTTGATCCAAATTCAAACCCCCCTTGCTAT AAGACCATGGACGAGGACATTGTGATTCAGCAGGACGATGAGATACGCTTGAAGATTGTAGGCACGCGTG TAGACAAGAATGACATTTTTGCCATTGGCTCTCTGATGGACGACTACTTGGGGCTGGTGAGCTGAGTGAG GGAGCGTCCAGCTTGGTTGGATCCTGATTTAGGAAGTGTGGCTTTCCGACTTGAGTTCAGCACCAACTTA ACTTTCCTACCGGAGGTTCAATCTGGCCACTGTTAGGGAGGCAAGAAAGGCTCCTTGTCCTCAGCTGTTT CTTCCAGCTGAGCTGTGCCCTGAGACTTTATTCTGTGCTCTAACCATAAACATGTTGTCCTTGTTTCTCA TGGAAATGTTGTCTTCTCTTGGTAGAAATTAAAGCTGTTATTTATTCTAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026329 |
| Insert Size | 519 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC005580, AAH05580 |
| RefSeq Size | 904 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 67710 |
| UniProt ID | P62488 |
| Gene Summary | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. RPB7 is part of a subcomplex with RPB4 that binds to a pocket formed by RPB1, RPB2 and RPB6 at the base of the clamp element. The RBP4-RPB7 subcomplex seems to lock the clamp via RPB7 in the closed conformation thus preventing double-stranded DNA to enter the active site cleft. The RPB4-RPB7 subcomplex binds single-stranded DNA and RNA. Binds RNA (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201451 | Polr2g (tGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g) |
CNY 2,850.00 |
|
| MR201451 | Polr2g (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g) |
CNY 2,400.00 |
|
| MR201451L3 | Lenti ORF clone of Polr2g (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g) |
CNY 4,750.00 |
|
| MR201451L4 | Lenti ORF clone of Polr2g (mGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g) |
CNY 4,750.00 |
