Polr2g (NM_026329) Mouse Untagged Clone

CAT#: MC200405

Polr2g (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide G (Polr2g), (10ug)



  "NM_026329" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410046K11Rik; A230108L04Rik; C76415; RBP7; Rpo2-7l
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005580 sequence for NM_026329
GCGCTGCGGAAGCGACCGCAGAGAAGTGGTGGGACTTCTGCAAGTGCTTCCGGAGAGGTCTCTGCGTGGG AAGTTCTGGGCGCTGCGGGCCAAGCTTCTGCAGAAGATGTTTTATCACATTTCCCTGGAGCACGAGATCC TCCTGCACCCACGATACTTCGGTCCAAACTTGCTCAACACGGTGAAGCAGAAGCTGTTTACCGAGGTGGA GGGGACCTGCACTGGGAAATATGGCTTTGTAATTGCTGTCACCACCATCGACAATATTGGTGCTGGTGTG ATCCAGCCAGGCCGAGGTTTTGTTCTTTATCCAGTGAAATACAAAGCTATTGTTTTCCGGCCCTTTAAAG GTGAAGTGGTGGATGCTGTGGTCACTCAGGTCAACAAGGTTGGACTTTTCACAGAAATTGGGCCTATGTC TTGCTTCATCTCTCGACATTCCATCCCTTCAGAGATGGAGTTTGATCCAAATTCAAACCCCCCTTGCTAT AAGACCATGGACGAGGACATTGTGATTCAGCAGGACGATGAGATACGCTTGAAGATTGTAGGCACGCGTG TAGACAAGAATGACATTTTTGCCATTGGCTCTCTGATGGACGACTACTTGGGGCTGGTGAGCTGAGTGAG GGAGCGTCCAGCTTGGTTGGATCCTGATTTAGGAAGTGTGGCTTTCCGACTTGAGTTCAGCACCAACTTA ACTTTCCTACCGGAGGTTCAATCTGGCCACTGTTAGGGAGGCAAGAAAGGCTCCTTGTCCTCAGCTGTTT CTTCCAGCTGAGCTGTGCCCTGAGACTTTATTCTGTGCTCTAACCATAAACATGTTGTCCTTGTTTCTCA TGGAAATGTTGTCTTCTCTTGGTAGAAATTAAAGCTGTTATTTATTCTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026329
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC005580, AAH05580
RefSeq Size 904 bp
RefSeq ORF 519 bp
Locus ID 67710
UniProt ID P62488
Gene Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. RPB7 is part of a subcomplex with RPB4 that binds to a pocket formed by RPB1, RPB2 and RPB6 at the base of the clamp element. The RBP4-RPB7 subcomplex seems to lock the clamp via RPB7 in the closed conformation thus preventing double-stranded DNA to enter the active site cleft. The RPB4-RPB7 subcomplex binds single-stranded DNA and RNA. Binds RNA (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...