Ucp1 (NM_009463) Mouse Untagged Clone

CAT#: MC200793

Ucp1 (untagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_009463" in other vectors (4)

CNY 2,000.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
UCP1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI385626; Slc25a7; Ucp
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012701 sequence for NM_009463
CCACGCGTCCGCTGGGCTTAACGGGTCCTCCCTGCCCGAGCAAGAGGAAGGGACGCTCACCTTTGAGCTG CTCCACAGCGCCGCCTCTGCACTGGCACTACCTAGCCCAGGTGGCTCTGCAGGAGTCCGAAGTCGCGGGT TTCGTGCCCGCATCAGGCAACAGTGCCACTGTTGTCTTCAGGGCTGAGTCCTTTTGTTCTTGCACTCACG CCTCTCTGCCCTCCAAGCCAGGATGGTGAACCCGACAACTTCCGAAGTGCAACCCACCATGGGGGTCAAG ATCTTCTCAGCCGGAGTTTCAGCTTGCCTGGCAGATATCATCACCTTCCCGCTGGACACTGCCAAAGTCC GCCTTCAGATCCAAGGTGAAGGCCAGGCTTCCAGTACCATTAGGTATAAAGGTGTCCTAGGGACCATCAC CACCCTGGCAAAAACAGAAGGATTGCCGAAACTGTACAGCGGTCTGCCTGCGGGCATTCAGAGGCAAATC AGCTTTGCCTCACTCAGGATTGGCCTCTACGACTCAGTCCAAGAGTACTTCTCTTCAGGGAGAGAAACAC CTGCCTCTCTCGGAAACAAGATCTCAGCCGGCTTAATGACTGGAGGTGTGGCAGTGTTCATTGGGCAGCC TACAGAGGTCGTGAAGGTCAGAATGCAAGCCCAGAGCCATCTGCATGGGATCAAACCCCGCTACACGGGG ACCTACAATGCTTACAGAGTTATAGCCACCACAGAAAGCTTGTCAACACTTTGGAAAGGGACGACCCCTA ATCTAATGAGAAATGTCATCATCAATTGTACAGAGCTGGTAACATATGACCTCATGAAGGGGGCCCTTGT AAACAACAAAATACTGGCAGATGACGTCCCCTGCCATTTACTGTCAGCTCTTGTTGCCGGGTTTTGCACC ACACTCCTGGCCTCTCCAGTGGATGTGGTAAAAACAAGATTCATCAACTCTCTGCCAGGACAGTACCCAA GCGTACCAAGCTGTGCGATGTCCATGTACACCAAGGAAGGACCGACGGCCTTTTTCAAAGGGTTTGTGGC TTCTTTTCTGCGACTCGGGTCCTGGAACGTCATCATGTTTGTGTGCTTTGAACAGCTGAAAAAAGAGCTG ATGAAGTCCAGACAGACAGTGGATTGTACCACATAAGCAACTTGGAGGAAGAGATACTGAACATCATTGG GCTTCTATGCTGGGAGACCACGAATAAAACCAACCAAAGAAATCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009463
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC012701, AAH12701
RefSeq Size 1249 bp
RefSeq ORF 924 bp
Locus ID 22227
UniProt ID P12242
Gene Summary Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance (PubMed:9139827, PubMed:19187776, PubMed:23063128, PubMed:27027295). Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP (PubMed:23063128). Regulates the production of reactive oxygen species/ROS by mitochondria (PubMed:20416274, PubMed:20466728).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...