Gemin7 (NM_027189) Mouse Untagged Clone
CAT#: MC201365
Gemin7 (untagged) - Mouse gem (nuclear organelle) associated protein 7 (Gemin7), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2400008I04Rik; AI120175; AI461688 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028527 sequence for NM_027189
GTAGGAGCAGCGCCTGCAGGGACAGGCCTTGCCAGAGCCATGCAGAGCCCACTGACCATTCCTGTGCCGG TGCCAGTGCTGCGCCTCCCTCGGGGCCCCGATGGCTTCAGCAGAGGCTTTGCCTCTGATGGACGTAGGAC CATCCTGAGACCAGAAGTCGGAGAAGGTCATATTCAAGATCCCCCAGAGTCACAGGAACAGCGGGCCCGA GCCACTCTGCGAGAGCGCTACCTCCGCAGCCTCCTAGCCATGGTGGGGCACCCTGTGAGTTTCACGCTGC ACGAAGGTGTGCATGTGACCGCCCAGTTTGGAGCCACAGACCTGGATGTGGCCAACTTCTACGTTTCCCA ACTGCAGACTCCCATAGGTGTACAGGCCGAGGCCTTGCTTCGATGTAGTGACATAATTTCCTATTCTTTC AAGCTGTAAAACTGTCTGCCATTTTCCTGTGGGCATTGCCACAGTAGCCCAGGCCTCTGACTATTCCTGG GACATAGAGTTCTCAGCGCCTTCCTGGACTTCCAAAGCAATCTCCAACAAACTCTGGCTTTGAACTCAGA GGAACTCCAAACCAGATACTGCCTGGTGCAGGATGCAGATAACCCTGGCTCTGAAGAGGTGGGAAGATCA TAAACTCAAGGCCAGGCTGTGCGGCAGTGGGGGACGGCAACCTCAGACATTCTAGATCTCTCTTGTTGGA AGGAGTGTTCTGCTTCACACACTGAGCGTCACAGAAATAAATTCCTGAGGCTTGGCCTTGCAAAAAAAAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_027189 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC028527, AAH28527 |
RefSeq Size | 789 bp |
RefSeq ORF | 390 bp |
Locus ID | 69731 |
UniProt ID | Q9CWY4 |
Gene Summary | The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200714 | Gemin7 (tGFP-tagged) - Mouse gem (nuclear organelle) associated protein 7 (Gemin7) |
CNY 2,850.00 |
|
MR200714 | Gemin7 (Myc-DDK-tagged) - Mouse gem (nuclear organelle) associated protein 7 (Gemin7) |
CNY 1,200.00 |
|
MR200714L3 | Lenti ORF clone of Gemin7 (Myc-DDK-tagged) - Mouse gem (nuclear organelle) associated protein 7 (Gemin7) |
CNY 4,750.00 |
|
MR200714L4 | Lenti ORF clone of Gemin7 (mGFP-tagged) - Mouse gem (nuclear organelle) associated protein 7 (Gemin7) |
CNY 4,750.00 |