Calca (NM_007587) Mouse Untagged Clone

CAT#: MC201376

Calca (untagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1, (10ug)



  "NM_007587" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Calcitonin gene-related peptide 1 (alpha-CGRP), guinea pig anti canine/mouse/rat, polyclonal.
    • 50 ul

CNY 9,600.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C; CA; Calc; Calc1; Cg; Cgrp; CGRP-1; CGRP1; Ct; Ctn
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC030071 sequence for NM_007587
AAGAGTCACCGCTTCGCAAGCACTGCCTGGCTCCATCAGGATCCCCGCAGGCTCAGCTCCAAGGCACCGC TCACCAGGAAGGCATCATGGGCTTCCTGAAGTTCTCCCCTTTCCTGGTTGTCAGCATCTTGCTCCTGTAC CAGGCATGCAGCCTCCAGGCAGTGCCTTTGAGGTCAATCTTGGAAAGCAGCCCAGGCATGGCCACTCTCA GTGAAGAAGAAGTTCGCCTGCTGGCTGCACTGGTGCAGGACTATATGCAGATGAAAGCCAGGGAGCTGGA GCAGGAGGAAGAGCAGGAGGCTGAGGGCTCTAGCTTGGACAGCCCCAGATCTAAGCGGTGTGGGAATCTG AGTACCTGCATGCTGGGCACGTACACACAAGACCTCAACAAGTTTCACACCTTCCCCAAAACTTCAATTG GGGTTGAAGCACCTGGCAAGAAAAGGGATGTGGCCAAGGACTTGGAGACAAACCACCAATCCCATTTTGG CAACTAAGCTCCTTCTCTCCTTTCTAGTTTCCTTCTTGCTTTCTTCCTATAACTTGATGCATGTAGTTCC TCTCTGGTTGCTCTCCAGGCTATTACTGGTTGCTTTCCTGAGGCAAAGAATGGTATCTGAAATCCCCAGT GGGTGAGGAGAAAGTCCCACAGGCTAAAAGAGAATCACCCAGGAAGATGGCAGAGAGCAAGGGCACACTC AGGAAGATGGCAGAGAGCAAGGGCAGTCATCTGGCTTCCTAGTAGAGCTTCTAGTCTTGCTTCTGGAAGT GTTGGTTGTTTGGGAAATAAAACTATTTTTTAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_007587
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC030071, AAH30071
RefSeq Size 857 bp
RefSeq ORF 411 bp
Locus ID 12310
UniProt ID P70160
Gene Summary This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide (CGRP) and katacalcin. Alternative splicing of the mRNA results in multiple variants that encode either calcitonin or CGRP preproproteins. Post-translational processing of the calcitonin and CGRP propeptides results in either calcitonin and katacalcin, or CGRP, respectively. Calcitonin and katacalcin modulate calcium levels in the blood stream. CGRP can function as a vasodilator and play a role in the transmission of pain. The human homolog of CGRP was found to have antimicrobial activity. [provided by RefSeq, Mar 2015]
Transcript Variant: This variant (1) encodes the longer isoform (Calca). Both variants 1 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...