Bola1 (NM_026975) Mouse Untagged Clone

CAT#: MC201396

Bola1 (untagged) - Mouse bolA-like 1 (E. coli) (Bola1), (10ug)



  "NM_026975" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Bola1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1810037G04Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027558 sequence for NM_026975
GGTGGTACAGCAGGCTGCGCAGCAAGTACAAAGCGAATGCTAAGTGCGCGATCGGCCCAGTGCATGGTCT CCATGGCCACGCGCTCGTGTGTATCGCGGGGCAGCGCGGGATCTGCGGCTGCAGGACCAGTGGAAGCCGC TATTCGCGCCAAATTGGAGCAAGCCCTGAGCCCCGAGGTACTGGAGCTGCGCAACGAGAGCGGTGGCCAC GCAGTCCCAGCAGGCAGCGAGACGCATTTTCGCGTGGCGGTGGTGAGCTCTCGTTTCGAGGGGATGAGCC CCTTGCAACGGCACCGGTTGGTCCACGAGGCACTGTCGGAGGAGCTGGCTGGACCGGTACATGCCCTGGC CATCCAGGCGAAGACCCCCGCCCAGTGGAGAGAAAACCCACAGTTGGACATTAGTCCCCCCTGCCTAGGT GGGAGCAAGAAAACTCGAGGGACCTCTTAATAAATACCTGGATTGGGAGAACGATCCGAATGGGTCGACT GAGAATAAACTACTACATCACTACTACCTTAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_026975
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027558, AAH27558
RefSeq Size 542 bp
RefSeq ORF 414 bp
Locus ID 69168
UniProt ID Q9D8S9
Gene Summary Acts as a mitochondrial iron-sulfur (Fe-S) cluster assembly factor that facilitates (Fe-S) cluster insertion into a subset of mitochondrial proteins (By similarity). Probably acts together with the monothiol glutaredoxin GLRX5. May protect cells against oxidative stress (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...