Bola1 (NM_026975) Mouse Untagged Clone
CAT#: MC201396
Bola1 (untagged) - Mouse bolA-like 1 (E. coli) (Bola1), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810037G04Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027558 sequence for NM_026975
GGTGGTACAGCAGGCTGCGCAGCAAGTACAAAGCGAATGCTAAGTGCGCGATCGGCCCAGTGCATGGTCT CCATGGCCACGCGCTCGTGTGTATCGCGGGGCAGCGCGGGATCTGCGGCTGCAGGACCAGTGGAAGCCGC TATTCGCGCCAAATTGGAGCAAGCCCTGAGCCCCGAGGTACTGGAGCTGCGCAACGAGAGCGGTGGCCAC GCAGTCCCAGCAGGCAGCGAGACGCATTTTCGCGTGGCGGTGGTGAGCTCTCGTTTCGAGGGGATGAGCC CCTTGCAACGGCACCGGTTGGTCCACGAGGCACTGTCGGAGGAGCTGGCTGGACCGGTACATGCCCTGGC CATCCAGGCGAAGACCCCCGCCCAGTGGAGAGAAAACCCACAGTTGGACATTAGTCCCCCCTGCCTAGGT GGGAGCAAGAAAACTCGAGGGACCTCTTAATAAATACCTGGATTGGGAGAACGATCCGAATGGGTCGACT GAGAATAAACTACTACATCACTACTACCTTAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_026975 |
Insert Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027558, AAH27558 |
RefSeq Size | 542 bp |
RefSeq ORF | 414 bp |
Locus ID | 69168 |
UniProt ID | Q9D8S9 |
Gene Summary | Acts as a mitochondrial iron-sulfur (Fe-S) cluster assembly factor that facilitates (Fe-S) cluster insertion into a subset of mitochondrial proteins (By similarity). Probably acts together with the monothiol glutaredoxin GLRX5. May protect cells against oxidative stress (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200850 | Bola1 (tGFP-tagged) - Mouse bolA-like 1 (E. coli) (Bola1) |
CNY 2,850.00 |
|
MR200850 | Bola1 (Myc-DDK-tagged) - Mouse bolA-like 1 (E. coli) (Bola1) |
CNY 1,200.00 |
|
MR200850L3 | Lenti ORF clone of Bola1 (Myc-DDK-tagged) - Mouse bolA-like 1 (E. coli) (Bola1) |
CNY 4,750.00 |
|
MR200850L4 | Lenti ORF clone of Bola1 (mGFP-tagged) - Mouse bolA-like 1 (E. coli) (Bola1) |
CNY 4,750.00 |