Insig2 (NM_133748) Mouse Untagged Clone

CAT#: MC201573

Insig2 (untagged) - Mouse insulin induced gene 2 (Insig2), transcript variant 1, (10ug)



  "NM_133748" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2900053I11Rik; C730043J18Rik; Insig-2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_133748, the custom clone sequence may differ by one or more nucleotides


ATGGCGGAAGGAGAGACGGAGTCACCTCGGCCTAAAAAGTGTGGCCCATACATTTCCTCTGTCACCAGCC
AGAGTGTGAACGTGGTGATCCGCGGGGTGGTACTCTTCTTCATTGGAGTGTTCCTGGCATTAGTGTTGAA
CTTGCTTCAGATTCAGAGAAACGTGACACTTTTTCCACCAGATGTGATCACGAGCATCTTTTCATCTGCC
TGGTGGGTACCACCATGCTGCGGCACAGCCTCAGCTGTGATTGGGCTGTTGTACCCCTGCATTGACAGGC
ATCTAGGAGAACCTCATAAATTTAAAAGAGAGTGGTCCAGTGTCATGCGCTGCGTGGCGGTGTTCGTGGG
TATAAATCACGCCAGTGCTAAAGTAGACTTCGACAACAACTTCCAGTTTTCCCTCACACTGGCTGCACTG
TCAGTAGGACTGTGGTGGACTTTTGACAGATCTAGAAGTGGTTTTGGCCTTGGTGTTGGAATTGCTTTCT
TAGCAACCGTTGTCACCCAACTGTTAGTCTACAATGGTGTTTATCAATACACATCTCCAGATTTTCTCTA
TGTCCGTTCTTGGTTGCCATGTATATTTTTTGCTGGAGGCATAACGATGGGAAACATTGGCCGTCAACTG
GCAATGTATGAATGCAAAGTTATTGCTGAAAAATCTCATCAAGAATGA


Restriction Sites RsrII-NotI     
ACCN NM_133748
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024411, AAH24411
RefSeq Size 1268 bp
RefSeq ORF 678 bp
Locus ID 72999
UniProt ID Q91WG1
Gene Summary Mediates feedback control of cholesterol synthesis by controlling SCAP and HMGCR. Functions by blocking the processing of sterol regulatory element-binding proteins (SREBPs). Capable of retaining the SCAP-SREBF2 complex in the ER thus preventing it from escorting SREBPs to the Golgi. Seems to regulate the ubiquitin-mediated proteasomal degradation of HMGCR.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...