Insig2 (NM_133748) Mouse Untagged Clone
CAT#: MC201573
Insig2 (untagged) - Mouse insulin induced gene 2 (Insig2), transcript variant 1, (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2900053I11Rik; C730043J18Rik; Insig-2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_133748, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAAGGAGAGACGGAGTCACCTCGGCCTAAAAAGTGTGGCCCATACATTTCCTCTGTCACCAGCC AGAGTGTGAACGTGGTGATCCGCGGGGTGGTACTCTTCTTCATTGGAGTGTTCCTGGCATTAGTGTTGAA CTTGCTTCAGATTCAGAGAAACGTGACACTTTTTCCACCAGATGTGATCACGAGCATCTTTTCATCTGCC TGGTGGGTACCACCATGCTGCGGCACAGCCTCAGCTGTGATTGGGCTGTTGTACCCCTGCATTGACAGGC ATCTAGGAGAACCTCATAAATTTAAAAGAGAGTGGTCCAGTGTCATGCGCTGCGTGGCGGTGTTCGTGGG TATAAATCACGCCAGTGCTAAAGTAGACTTCGACAACAACTTCCAGTTTTCCCTCACACTGGCTGCACTG TCAGTAGGACTGTGGTGGACTTTTGACAGATCTAGAAGTGGTTTTGGCCTTGGTGTTGGAATTGCTTTCT TAGCAACCGTTGTCACCCAACTGTTAGTCTACAATGGTGTTTATCAATACACATCTCCAGATTTTCTCTA TGTCCGTTCTTGGTTGCCATGTATATTTTTTGCTGGAGGCATAACGATGGGAAACATTGGCCGTCAACTG GCAATGTATGAATGCAAAGTTATTGCTGAAAAATCTCATCAAGAATGA |
Restriction Sites | RsrII-NotI |
ACCN | NM_133748 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024411, AAH24411 |
RefSeq Size | 1268 bp |
RefSeq ORF | 678 bp |
Locus ID | 72999 |
UniProt ID | Q91WG1 |
Gene Summary | Mediates feedback control of cholesterol synthesis by controlling SCAP and HMGCR. Functions by blocking the processing of sterol regulatory element-binding proteins (SREBPs). Capable of retaining the SCAP-SREBF2 complex in the ER thus preventing it from escorting SREBPs to the Golgi. Seems to regulate the ubiquitin-mediated proteasomal degradation of HMGCR.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202632 | Insig2 (tGFP-tagged) - Mouse insulin induced gene 2 (Insig2) |
CNY 2,850.00 |
|
MR202632 | Insig2 (Myc-DDK-tagged) - Mouse insulin induced gene 2 (Insig2), transcript variant 1 |
CNY 2,400.00 |
|
MR202632L3 | Lenti ORF clone of Insig2 (Myc-DDK-tagged) - Mouse insulin induced gene 2 (Insig2), transcript variant 1 |
CNY 4,750.00 |
|
MR202632L4 | Lenti ORF clone of Insig2 (mGFP-tagged) - Mouse insulin induced gene 2 (Insig2), transcript variant 1 |
CNY 4,750.00 |