Fcer1g (NM_010185) Mouse Untagged Clone
CAT#: MC201832
Fcer1g (untagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI573376; CD23; Fce1g; FcepsilonRI; FcR-gamma; FcRgamma; FcR[g]; Ly-50 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC034163 sequence for NM_010185
CGCGATCACCAGCTCCCAGCGCCGCAGCCCCCAGCGCACCCAGGATGATCTCAGCCGTGATCTTGTTCTT GCTCCTTTTGGTGGAACAAGCAGCCGCCCTGGGAGAGCCGCAGCTCTGCTATATCCTGGATGCTGTCCTG TTTTTGTATGGTATTGTCCTTACCCTACTCTACTGTCGACTCAAGATCCAGGTCCGAAAGGCAGCTATAG CCAGCCGTGAGAAAGCAGATGCTGTCTACACGGGCCTGAACACCCGGAGCCAGGAGACATATGAGACTCT GAAGCATGAGAAACCACCCCAGTAGCTTCAGAACAGACGTGCTTGGCTGCATTCTTTTCCCACTTCTAAT TCTCTCCGAGCCCTCTTGGTCACCTCTGTGCTTTGAAGGTTGGCTGACCTTATTCACATAATGATGCTAG CTAGGCTCTACATCAGTGTACACTGGCAGGTCCCCATCTCCGTTAAAGACTTACTCACTGACATTTCTCT TCTTCCAGCCTCCTTTGCTTCATTTCTTTTTCCTTCCCTGATCCTCGACTCTCACTAAACAATGGAAAGG GATTATCCCCCAATAAAGCTGCCAGAGACCTGACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010185 |
Insert Size | 261 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC034163, AAH34163 |
RefSeq Size | 800 bp |
RefSeq ORF | 261 bp |
Locus ID | 14127 |
UniProt ID | P20491 |
Gene Summary | Adapter protein containing an immunoreceptor tyrosine-based activation motif (ITAM) that transduces activation signals from various immunoreceptors. As a component of the high-affinity immunoglobulin E (IgE) receptor, mediates allergic inflammatory signaling in mast cells (PubMed:14764707). As a constitutive component of interleukin-3 receptor complex, selectively mediates interleukin 4/IL4 production by basophils, priming T-cells toward effector T-helper 2 subset (PubMed:19098920). Associates with pattern recognition receptors CLEC4D and CLEC4E to form a functional signaling complex in myeloid cells. Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of ITAM, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766) (Probable). May function cooperatively with other activating receptors. Functionally linked to integrin beta-2/ITGB2-mediated neutrophil activation (PubMed:17086186). Also involved in integrin alpha-2/ITGA2-mediated platelet activation (PubMed:9171347).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201831 | Fcer1g (untagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g), (10ug) |
CNY 1,200.00 |
|
MR200193 | Fcer1g (Myc-DDK-tagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g) |
CNY 1,200.00 |
|
MR200193L3 | Lenti ORF clone of Fcer1g (Myc-DDK-tagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g) |
CNY 3,600.00 |
|
MR200193L4 | Lenti ORF clone of Fcer1g (mGFP-tagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g) |
CNY 4,750.00 |