Mgp (NM_008597) Mouse Untagged Clone
CAT#: MC202781
Mgp (untagged) - Mouse matrix Gla protein (Mgp), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Mg; Mglap |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC079478 sequence for NM_008597
CTCCCCTCTGCTGCTGCTGCTGCTGCGCCAGACACAGAGGCAGACTCACAGGACACCCGAGACACCATGA AGAGCCTGCTCCCTCTGGCCATCCTGGCTGCGCTGGCCGTGGCAACCCTGTGCTACGAATCTCACGAAAG CATGGAGTCCTATGAAATCAGTCCCTTCATCAACAGGAGAAATGCCAACACCTTTATGTCCCCTCAGCAG AGGTGGCGAGCTAAAGCCCAAAAGAGAGTCCAGGAACGCAACAAGCCTGCCTACGAGATCAACAGAGAGG CCTGCGATGACTACAAGCTGTGTGAGCGCTACGCCATGGTCTACGGCTACAACGCTGCCTACAACCGCTA CTTCAGGCAGCGCCGAGGAGCCAGATATTAGCGCGAAGAAACAGTCATTTGGTTGTGGAGTTTCGTTTTA TATCTCCTGCAGTAGCATTACTGAAGTATACAGACACGCATGCGTTGCTTGCTCCTTACATGATCTCCTA GCTGGCTGGCCCACTCCTTCCTTCCGCGGGTTGAAAGTAATGAAAGAGCAGTATTAAGAAGTGTGTTTAT ATATAATAAAATTCTGGTTTGATACGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008597 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC079478, AAH79478 |
RefSeq Size | 617 bp |
RefSeq ORF | 315 bp |
Locus ID | 17313 |
UniProt ID | P19788 |
Gene Summary | This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. This protein also inhibits angiogenesis. Mice lacking a functional copy of this gene exhibit impaired differentiation of endothelial cells, reduced stature, and calcification and rupture of the vasculature leading to premature death. [provided by RefSeq, Sep 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200346 | Mgp (tGFP-tagged) - Mouse matrix Gla protein (Mgp) |
CNY 2,800.00 |
|
MR200346 | Mgp (Myc-DDK-tagged) - Mouse matrix Gla protein (Mgp) |
CNY 1,200.00 |
|
MR200346L3 | Lenti ORF clone of Mgp (Myc-DDK-tagged) - Mouse matrix Gla protein (Mgp) |
CNY 4,750.00 |
|
MR200346L4 | Lenti ORF clone of Mgp (mGFP-tagged) - Mouse matrix Gla protein (Mgp) |
CNY 4,750.00 |