Med8 (NM_020000) Mouse Untagged Clone

CAT#: MC203111

Med8 (untagged) - Mouse mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) (Med8), transcript variant 1, (10ug)



  "NM_020000" in other vectors (3)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210021A15Rik; AB041805; ARC32
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021870
CGCCGGGCCGCGGCAATGCAGAGGGAGGAGAAGCAGCTTGAGGCATCATTAGATGCCCTGCTGAATCAAG TGGCCGATCTGAAGAATTCACTGGGGAGTTTCATTTACAAGTTGGAAAACGAGTATGACCGGCTGACCTG GCCCTCTGTCCTGGACAGCTTTGCATTGCTTTCTGGACAGTTGAACACTCTGAACAAGGTCTTAAAGCAT GAGAAGACGCCACTGTTCCGAAACCAGGTCATCATCCCTCTGGTGCTGTCCCCAGACCGAGACGAAGACC TCATGCGTCAAACTGAAGGACGAGTGCCTGTTTTCAGCCATGAGGTCGTCCCTGACCACTTGAGAACCAA GCCTGACCCTGAAGTTGAAGAGCAGGAGAAGCAACTGACAACAGATGCTGCCAGAATTGGTGCTGATGCA GCTCAGAAGCAGATCCAGAGCTTGAATAAAATGTGCTCAAACCTTTTAGAGAAAATCAGCAAAGAAGAAC GAGAATCAGAGAGCGGAGGTCTCCGGCCAAACAAGCAGACTTTCAACCCTGGAGACACCAATGCCTTAGT AGCAGCCGTTGCCTTTGGGAAGGGGCTATCTAATTGGCGACCTTCAGGTAGCAGTGGTCCTGGGCAACCC GGTCAGCCAGGAGCTGGTACAATCCTTGCAGGGGCCTCAGGATTACCGCAGGTTCAGATGCCAGGTGCTC CAAACCAGCAGCAGCCAATGCTCAGTGGAGTCCAGATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAG TGGAATAAAAACCAACATCAAGTCAGCTTCAATGCATCCGTACCAGCGGTGAGTGTGGACGGCAGCCTCC ACTCTCAGGTGATCTGTGCTGAGTTGAGCAATGACATGATTTTTTGCTCAAGGCTTATTTAGATGGGGAC AATAAAAAGAACACAGGCTTTCGGCAAGAGACAGATCTCAGCTCCACTGTGAATAGCCATTCGAACTTGG GAAAGTGACCTAATATTTCTGAGCCTGTGTTCTCATTTGTAGATGGTGATAATACCTACCTCATAGGGTT GTTGTGAGGATTAAAATGAGAAAATGAATGTAAAACACTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_020000
Insert Size 807 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021870, AAH21870
RefSeq Size 1141 bp
RefSeq ORF 807 bp
Locus ID 80509
UniProt ID Q9D7W5
Gene Summary Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. May play a role as a target recruitment subunit in E3 ubiquitin-protein ligase complexes and thus in ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...