Arl3 (NM_019718) Mouse Untagged Clone
CAT#: MC203496
Arl3 (untagged) - Mouse ADP-ribosylation factor-like 3 (Arl3), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC042941
GGAGGAGGAGGCGGAGGAGGAGGAGGAGGGACTCGGCTTGAGGATGGGCTTGCTCTCTATTTTGCGCAAA TTGAAAAGTGCACCAGACCAGGAGGTGCGAATCCTACTCCTGGGCTTGGACAACGCGGGCAAGACTACCT TGCTGAAGCAACTCGCATCTGAAGACATCAGCCACATCACACCTACACAGGGATTTAACATCAAAAGCGT GCAGTCACAAGGTTTTAAGCTGAATGTATGGGACATTGGCGGGCAGAGGAAAATCAGACCATACTGGAGA AGTTATTTTGAAAATACTGATATTCTCATCTATGTAATTGACAGTGCCGACAGAAAGAGATTTGAAGAGA CGGGTCAGGAACTAACGGAATTACTGGAGGAAGAAAAGCTGAGTTGTGTGCCCGTGCTCATCTTTGCTAA CAAGCAGGACCTGCTCACGGCAGCCCCAGCCTCCGAGATCGCAGAAGGGCTAAACCTCCACACCATCCGG GACCGCGTCTGGCAGATCCAGTCCTGTTCAGCGCTCACAGGCGAGGGCGTCCAGGATGGCATGAACTGGG TCTGCAAGAATGTCAACGCAAAGAAGAAATAAAACGGAGGCAGGCGGATGGTGGCGCTGGAGCCGGGAGC TAGAGTCAGCCCTAGAAACACTGGGTTGCTGCTTTCTGACCAAATGCTTTTCTGTCTGTGCACAGCCACA GCTGTGTGGCGGGCGGGGAGGGACAGCAGCCTGAGAAAGATCCCCATCCCAGCAGTAGATTTTAACTGAT CTCAGAGGCTCGGTATCGTTTTTCAAATAAAGGAATTATATTATTTCCTCTGAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_019718 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC042941, AAH42941 |
RefSeq Size | 838 bp |
RefSeq ORF | 549 bp |
Locus ID | 56350 |
UniProt ID | Q9WUL7 |
Gene Summary | Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP) (PubMed:18376416). Required for normal cytokinesis and cilia signaling. Required for targeting proteins to the cilium, including myristoylated NPHP3 and prenylated INPP5E. Targets NPHP3 to the ciliary membrane by releasing myristoylated NPHP3 from UNC119B cargo adapter into the cilium (By similarity). Requires assistance from GTPase-activating proteins (GAPs) like RP2 and PDE6D, in order to cycle between inactive GDP-bound and active GTP-bound forms (PubMed:15979089). Required for PKD1:PKD2 complex targeting from the trans-Golgi network to the cilium (PubMed:25405894).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201653 | Arl3 (tGFP-tagged) - Mouse ADP-ribosylation factor-like 3 (Arl3) |
CNY 2,850.00 |
|
MR201653 | Arl3 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 3 (Arl3) |
CNY 2,400.00 |
|
MR201653L3 | Lenti ORF clone of Arl3 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 3 (Arl3) |
CNY 4,750.00 |
|
MR201653L4 | Lenti ORF clone of Arl3 (mGFP-tagged) - Mouse ADP-ribosylation factor-like 3 (Arl3) |
CNY 4,750.00 |