United States
Germany
Japan
United Kingdom
China
Acot13 (NM_025790) Mouse Untagged Clone
CAT＃: MC203714
Acot13 (untagged) - Mouse acyl-CoA thioesterase 13 (Acot13), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610006O17Rik; Them2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC018165
TGATCATCTAGGACCAGGGCGACCGGGGCGCGCGATCCTTTCTCCCGAGCACGACGCGACACCGCCCGGG CTTGCAGACTTGACCTTCCACACCCTTGTCCTCTCACAAACGTCTCTTCCAGAGTTCACTCTCGCAGAGC CCAGACTCTTGCTTTGCGTCCACGATGAGCAGCATGACCCAGAACCTACGAGAAGTAATGAAGGTTATGT TCAAAGTTCCCGGTTTTGATAGAGTTTTGGAAAAGGTGACGCTTGTCTCGGCTGCTCCTGAGAAACTAAT CTGTGAGATGAAGGTGGAGGAGCAGCATACTAATAAGCTGGGTACGCTCCATGGAGGCTTGACAGCAACC TTAGTGGACAGCATCTCGACCATGGCTCTAATGTGCACAGAAAGAGGAGCACCCGGAGTCAGTGTGGACA TGAACATAACGTACATGTCACCTGCTAAGATAGGAGAAGAAATAGTGATCACAGCACACATTCTGAAGCA AGGAAAGACACTTGCATTTGCCTCAGTGGATCTGACCAACAAGACCACAGGAAAATTAATAGCACAAGGC AGACACACAAAACACCTGGGGAACTGAGAACAGCGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATG GTTTGTGAACAACTTTCTGAAATAAATTATCAAAACCAGAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025790 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC018165, AAH18165 |
| RefSeq Size | 689 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 66834 |
| UniProt ID | Q9CQR4 |
| Gene Summary | Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs to the free fatty acid and coenzyme A (CoASH), providing the potential to regulate intracellular levels of acyl-CoAs, free fatty acids and CoASH. Has acyl-CoA thioesterase activity towards medium (C12) and long-chain (C18) fatty acyl-CoA substrates. Can also hydrolyze 3-hydroxyphenylacetyl-CoA (in vitro). May play a role in controlling adaptive thermogenesis.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200881 | Acot13 (tGFP-tagged) - Mouse thioesterase superfamily member 2 (Them2) |
CNY 2,850.00 |
|
| MR200881 | Acot13 (Myc-DDK-tagged) - Mouse acyl-CoA thioesterase 13 (Acot13) |
CNY 1,200.00 |
|
| MR200881L3 | Lenti ORF clone of Acot13 (Myc-DDK-tagged) - Mouse acyl-CoA thioesterase 13 (Acot13) |
CNY 4,750.00 |
|
| MR200881L4 | Lenti ORF clone of Acot13 (mGFP-tagged) - Mouse acyl-CoA thioesterase 13 (Acot13) |
CNY 4,750.00 |
