Mettl1 (NM_010792) Mouse Untagged Clone
CAT#: MC203767
Mettl1 (untagged) - Mouse methyltransferase like 1 (Mettl1), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810012D02Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012649
CCACGCGTCCGCGGACGCGTGGGCGCGAGCTCGGCTCTCCACGTGGACTGCGTGGCATGATGGCGGGAGC CGAAGCCCCCCAGCCGCAGAAGCGCTACTACCGGCAGCGCGCCCACTCCAACCCCATGGCAGACCACACA CTGCGCTACCCTGTGAAGCCAGAGGAAATGGACTGGTCTGAGCTTTACCCAGAGTTCTTTGCTCCGCTTA ATCAAAATAAGAACCATGATGATCCAAAGGATGAGAAAGAAAAGCACTCTGGGGCCCAAGTGGAGTTTGC AGACATAGGCTGTGGCTATGGTGGCTTGTTAGTGGCACTGTCACCGCTCTTCCCAGATACCCTGATTCTG GGTCTGGAGATTCGGGTGAAGGTGTCGGACTATGTGCAGGACAGGATTCGGGCCCTCCGTGCAGCTCCCG GGGGCGGATTCCAGAACATCGCCTGTCTCCGAAGTAACGCCATGAAACACCTTCCTAATTTCTTCCGCAA GGGCCAGCTGGCAAAGATGTTCTTCCTCTTCCCGGACCCACACTTTAAGCGAACGAAGCATAAATGGAGA ATCATCAGCCCTACGCTTCTGGCAGAGTATGCCTACGTGCTGAGAGTCGGGGGCCTGGTGTACACCGTCA CCGACGTGCCGGAGCTGCATGAGTGGATGTGCACCCACTTTGAAGAACACCCACTATTTGAGTGTGTGCC TCTTGAAGAGCTAAGTGAAGACCCCATTGTGGAACATCTAGGCAGTTCAACTGAGGAAGGAAAGAAAGTT CTACGCAATGGGGGAAAGAATTTCCCAGCCGTCTTCCGAAGAATACAGGATCCCCTCCTCCAGGCAGTGA CCCCCAACCCCACCCTGCCTTAGCCAGACCCCCTAGAAGGTGACTGGAAAAAAGATCAAAAAAAAAAAAA AAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010792 |
Insert Size | 807 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC012649, AAH12649 |
RefSeq Size | 919 bp |
RefSeq ORF | 807 bp |
Locus ID | 17299 |
UniProt ID | Q9Z120 |
Gene Summary | Methyltransferase that mediates the formation of N(7)-methylguanine in a subset of RNA species, such as tRNAs, mRNAs and microRNAs (miRNAs) (PubMed:29983320). Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA. Also acts as a methyltransferase for a subset of internal N(7)-methylguanine in mRNAs (PubMed:29983320). Internal N(7)-methylguanine methylation of mRNAs regulates translation (PubMed:29983320). Also methylates a specific subset of miRNAs, such as let-7. N(7)-methylguanine methylation of let-7 miRNA promotes let-7 miRNA processing by disrupting an inhibitory secondary structure within the primary miRNA transcript (pri-miRNA) (By similarity). Acts as a regulator of embryonic stem cell self-renewal and differentiation (PubMed:29983320).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203548 | Mettl1 (tGFP-tagged) - Mouse methyltransferase-like 1 (Mettl1) |
CNY 2,850.00 |
|
MR203548 | Mettl1 (Myc-DDK-tagged) - Mouse methyltransferase like 1 (Mettl1) |
CNY 2,400.00 |
|
MR203548L3 | Lenti ORF clone of Mettl1 (Myc-DDK-tagged) - Mouse methyltransferase like 1 (Mettl1) |
CNY 4,750.00 |
|
MR203548L4 | Lenti ORF clone of Mettl1 (mGFP-tagged) - Mouse methyltransferase like 1 (Mettl1) |
CNY 4,750.00 |