Polr2f (NM_027231) Mouse Untagged Clone
CAT#: MC204220
Polr2f (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810060D16Rik; RPB6 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024419
GGCAAAGGCGCGCGTTCTCTGCTCTGCGCCCCGGGCGGAGAAGGCATCATGTCAGACAACGAGGACAATT TCGACGGCGACGACTTTGATGACGTTGAGGAGGACGAAGGACTTGACGACTTGGAAAATGCTGAGGAGGA GGGCCAGGAAAATGTCGAGATTCTCCCATCTGGTGAGCGACCACAGGCCAACCAGAAGCGGATCACCACT CCTTACATGACCAAGTATGAGCGTGCCCGAGTGCTGGGCACCCGGGCTCTTCAGATCGCGATGTGTGCCC CGGTGATGGTGGAGCTGGAGGGGGAGACAGACCCTTTGCTCATCGCCATGAAGGAACTCAAGGCGCGGAA GATCCCCATCATCATTCGCCGGTACCTGCCAGACGGCAGCTATGAGGACTGGGGCGTGGACGAGCTTATC ATCAGCGACTGAGCCGGGCGCGCTCGGCCTGCACCAGCTCTGCTGGGCACCCTCTCTGTGCCCGTTTTAT ATGTGTAAATAATAAACCTCACCCTTTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_027231 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024419, AAH24419 |
RefSeq Size | 612 bp |
RefSeq ORF | 384 bp |
Locus ID | 69833 |
UniProt ID | P61219 |
Gene Summary | DNA-dependent RNA polymerases catalyze the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and small RNAs, such as 5S rRNA and tRNAs, respectively. Pol II is the central component of the basal RNA polymerase II transcription machinery. Pols are composed of mobile elements that move relative to each other. In Pol II, POLR2F/RPB6 is part of the clamp element and together with parts of RPB1 and RPB2 forms a pocket to which the RPB4-RPB7 subcomplex binds (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200686 | Polr2f (tGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f) |
CNY 2,850.00 |
|
MR200686 | Polr2f (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f) |
CNY 1,200.00 |
|
MR200686L3 | Lenti ORF clone of Polr2f (Myc-DDK-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f) |
CNY 4,750.00 |
|
MR200686L4 | Lenti ORF clone of Polr2f (mGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f) |
CNY 4,750.00 |