Il15 (NM_008357) Mouse Untagged Clone

CAT#: MC204242

Il15 (untagged) - Mouse interleukin 15 (Il15), (10ug)



  "NM_008357" in other vectors (6)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI503618; IL-15
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC023698
CCACGCGTCCGCAATACTCAGTGGCACTGTATTCCCCTTCTGTCCAGCCACTCTTCCCCAGAGTTCTCTT CTTCATCCTCCCCCTTGCAGAGTAGGGCAGCTTGCAGGTCCTCCTGCAAGTCTCTCCCAATTCTCTGCGC CCAAAAGACTTGCAGTGCATCTCCTTACGCGCTGCAGGGACCTTGCCAGGGCAGGACTGCCCCCGCCCAG TTGCAGAGTTGGACGAAGACGGGATCCTGCTGTGTTTGGAAGGCTGAGTTCCACATCTAACAGCTCAGAG AGAATCCACCTTGACACATGGCCCTCTGGCTCTTCAAAGCACTGCCTCTTCATGGTCCTTGCTGGTGAGG TCCTTAAGAACACAGAAACCCATGTCAGCAGATAACCAGCCTACAGGAGGCCAAGAAGAGTTCTGGATGG ATGGCAGCTGGAAGCCCATCGCCATAGCCAGCTCATCTTCAACATTGAAGCTCTTACCTGGGCATTAAGT AATGAAAATTTTGAAACCATATATGAGGAATACATCCATCTCGTGCTACTTGTGTTTCCTTCTAAACAGT CACTTTTTAACTGAGGCTGGCATTCATGTCTTCATTTTGGGCTGTGTCAGTGTAGGTCTCCCTAAAACAG AGGCCAACTGGATAGATGTAAGATATGACCTGGAGAAAATTGAAAGCCTTATTCAATCTATTCATATTGA CACCACTTTATACACTGACAGTGACTTTCATCCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTG GAATTGCAGGTTATTTTACATGAGTACAGTAACATGACTCTTAATGAAACAGTAAGAAACGTGCTCTACC TTGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGA GGAGAAAACCTTCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAACACGTCCTGA CTGCATGCGAGCCTCTTCCGTGTTTCTGTTATTAAGGTACCTCCACCTGCTGCTCAGAGGCAGCACAGCT CCATGCATTTGAAATCTGCTGGGCAAATTAAGCTTCCTAACAAGGAGATAATGAGCCACTTGGATCACAT GAAATCTTGGAAATGAAGAGAGGAAAAGAGCTCGTCTCAGACTTATTTTTGCTTGCTTATTTTTAATTTA TTGCTTCATTTGTACATATTTGTAATATAACAGAAGATGTGGAATAAAGTTGTATGGATATTTTATCAAT TGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008357
Insert Size 489 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC023698, AAH23698
RefSeq Size 1312 bp
RefSeq ORF 489 bp
Locus ID 16168
UniProt ID P48346
Gene Summary This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...