Vamp8 (NM_016794) Mouse Untagged Clone
CAT#: MC204264
Vamp8 (untagged) - Mouse vesicle-associated membrane protein 8 (Vamp8), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AU041171; Edb; endobrevin |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012668
CCACGCGTCCGGGAGGCGGGCTGAAAGTTGGAGTAAGCAGGAAGTGAAGCTGTGGCTGCCTTGGGTGGAA ACAGACTAGGCGAAGTTCTGCTTTGAGAGGCCCAAGTGCTCCGAGACATGGAGGAGGCCAGTGGGAGTGC CGGAAATGACCGAGTTAGGAACCTGCAGAGTGAGGTGGAGGGAGTCAAGAATATTATGACCCAGAATGTG GAGCGGATCTTGGCCAGAGGGGAGAACCTGGACCACCTCCGAAACAAGACAGAGGACTTGGAAGCCACGT CTGAACACTTCAAGACAACGTCCCAGAAGGTGGCCCGGAAGTTCTGGTGGAAGAATGTGAAGATGATTGT CATCATCTGTGTGATTGTCCTTATCATCGTCATCCTCATTATACTTTTTGCCACTGGTACCATCCCCACT TAAGAGTCCCTTCCATCCCACCCTACTCCTCAGGGGTGACCTCCCTAATATGTGCCAAGAGGAGCCCTCT CCTGTCCTCCTCCACCCAAGTGCTGCTCAGTCCCTGTGAGGGCCTTCTGCTGCATCAGATGCCCCAGACG CACCTTGATCCCCTGGGAGGAGACAGCTGGACTGTAGCTGCATCTCATGGTCCTGAGAGTGGGTTACAGA GACCCAGAGGACCCTGTCTGTGGCTGGGAAACTGTTGGTGGCTGGTGGGCAATAAAGACCTCTTGGTATC CCTAAGTGTAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_016794 |
Insert Size | 306 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC012668, AAH12668 |
RefSeq Size | 730 bp |
RefSeq ORF | 306 bp |
Locus ID | 22320 |
UniProt ID | O70404 |
Gene Summary | SNAREs, soluble N-ethylmaleimide-sensitive factor-attachment protein receptors, are essential proteins for fusion of cellular membranes. SNAREs localized on opposing membranes assemble to form a trans-SNARE complex, an extended, parallel four alpha-helical bundle that drives membrane fusion. VAMP8 is a SNARE involved in autophagy through the direct control of autophagosome membrane fusion with the lysososome membrane via its interaction with the STX17-SNAP29 binary t-SNARE complex (By similarity). Also required for dense-granule secretion in platelets (By similarity). Plays also a role in regulated enzyme secretion in pancreatic acinar cells (PubMed:15363411). Involved in the abscission of the midbody during cell division, which leads to completely separate daughter cells (By similarity). Involved in the homotypic fusion of early and late endosomes (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200318 | Vamp8 (tGFP-tagged) - Mouse vesicle-associated membrane protein 8 (Vamp8) |
CNY 2,850.00 |
|
MR200318 | Vamp8 (Myc-DDK-tagged) - Mouse vesicle-associated membrane protein 8 (Vamp8) |
CNY 1,200.00 |
|
MR200318L3 | Lenti ORF clone of Vamp8 (Myc-DDK-tagged) - Mouse vesicle-associated membrane protein 8 (Vamp8) |
CNY 4,750.00 |
|
MR200318L4 | Lenti ORF clone of Vamp8 (mGFP-tagged) - Mouse vesicle-associated membrane protein 8 (Vamp8) |
CNY 4,750.00 |