Nudt1 (NM_008637) Mouse Untagged Clone

CAT#: MC204305

Nudt1 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 1 (Nudt1), (10ug)



  "NM_008637" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Mth1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021940
CGGACGCGTCCGCCCACGCGTCCGCCGCCCCGGGAAACTTTGGCTGGGGCGCGAAGGACCCAGGAGAGCA TGAGCACCTCCAGGCTTTATACCCTTGTGCTAGTGCTACAGCCTCAGCGAGTTCTCCTGGGCATGAAGAA GAGGGGCTTTGGTGCTGGCCGCTGGAATGGCTTCGGGGGCAAGGTGCAGGAAGGAGAGACCATTGAGGAT GGGGCTAAGAGAGAGCTGCTGGAAGAAAGTGGTCTGAGCGTGGATACACTGCACAAGGTAGGCCACATCT CGTTTGAATTTGTGGGCTCCCCTGAGCTGATGGACGTGCATATCTTCTCGGCTGACCATGTGCACGGGAC GCCCACAGAGAGTGAAGAAATGCGCCCTCAGTGGTTCCAACTGGACCAGATCCCCTTTGCCGACATGTGG CCGGATGACAGCTACTGGTTCCCACTCCTGCTTCAGAAGAAGAAGTTCTGTGGGCACTTCAAGTTCCAGG ATCAGGACACGATCCTCAGTTACTCGCTGCGAGAGGTGGACTCATTCTAATACAGAACTCTGGCTGGTTC TGGCCACTCAGGATGCTACACAGCCGCAAGCTGTCGGACCAAGGGCACAAGCAGGGGCTGGTATTTTCTG TGTGCGAGGGGTTGGGGTTGAAATGTGAAATGTCACCAATACACCAATGTTTGAATTCTTCGTCCCCACA TACTGGTCCTGTTTTAGAAGGTTGTGGCACCTTTAAGAGCCAGAGCCCTGCTGGTGGAACTGAGTCACTG GGGATCGGAGAATGGAGGATGGGCCTTGCTTTATAGGTGAGCACCGCTTACTGTCTGCTCACACTCCGGC TACTGTGTCAGATTTTCCACGATGGACTGTGTCCCCAGATGGATGAGCTGAAATAAACCGTTGCTCCTCT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008637
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021940, AAH21940
RefSeq Size 975 bp
RefSeq ORF 471 bp
Locus ID 17766
UniProt ID P53368
Gene Summary Antimutagenic (PubMed:11572992). Plays a redundant role in sanitizing oxidized nucleotide pools, such as 8-oxo-dGTP pools (PubMed:29281266). Acts as a sanitizing enzyme for oxidized nucleotide pools, thus suppressing cell dysfunction and death induced by oxidative stress. Hydrolyzes 8-oxo-dGTP, 8-oxo-dATP and 2-OH-dATP, thus preventing misincorporation of oxidized purine nucleoside triphosphates into DNA and subsequently preventing A:T to C:G and G:C to T:A transversions. Able to hydrolyze also the corresponding ribonucleotides, 2-OH-ATP, 8-oxo-GTP and 8-oxo-ATP (By similarity). Does not play a role in U8 snoRNA decapping activity (PubMed:21070968). Binds U8 snoRNA (PubMed:21070968).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the predominant transcript. All four variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...