Ndufab1 (NM_028177) Mouse Untagged Clone

CAT#: MC204981

Ndufab1 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_028177" in other vectors (5)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 8kDa; 2210401F17Rik; 2310039H15Rik; 2610003B19Rik; 9130423F15Rik; ACP; CI-SDAP; SDAP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC060951
ATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTCTGCGCCTGTGTCCGCCGCCTGCCCGCGGCCTTC GCGCCGCTGCCCCGGCTTCCCACGTTGGCCTTGGCGCGGCCGCTCAGCACCACCCTATGCCCTGAGGGAA TCCGGAGGAGACCCGGGGCTCTGCAGTCCGCCTTGGCGCTCGCGCAGGTGCCTGGAACAGTCACACATTT GTGCCGCCAGTACAGTGACGCACCCCCACTGACGTTAGACGGAATCAAGGACCGAGTTCTGTATGTCTTG AAACTCTATGATAAGATTGATCCAGAAAAGCTCTCCGTAAATTCTCATTTTATGAAGGACCTGGGCTTAG ACAGTTTGGACCAAGTGGAAATTATTATGGCCATGGAAGACGAATTTGGGTTTGAAATTCCTGATATAGA TGCAGAGAAGTTAATGTGTCCACAAGAAATTGTAGATTACATTGCAGATAAGAAGGATGTGTATGAATAA AGTATCAGAGCCTTCTTCCTCACTGTGAGGACTCCAGAGGACACACGATGGCATCGTGGCCGACTGACAG CGGCTCTGTTCAACTTGTATTTAAATTGTCTGAGTGTTTTACCCGTTAAAAATAAATCTATTACAAAACA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_028177
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC060951, AAH60951
RefSeq Size 659 bp
RefSeq ORF 471 bp
Locus ID 70316
UniProt ID Q9CR21
Gene Summary Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity). Accessory and non-catalytic subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...