United States
Germany
Japan
United Kingdom
China
Cd160 (NM_018767) Mouse Untagged Clone
CAT＃: MC205782
Cd160 (untagged) - Mouse CD160 antigen (Cd160), transcript variant 2, (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AU045688; By55 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC021596
GCAAGGAAGAACATCTGTCCTGAGGAGTGTGCAGCCACAGACCAGCAAAGTCAACATTTCCGTGAAATTC CTGGGGCTGACAACAGCATGCAAAGAATCCTGATGGCCCCTGGCCAAAGCTGCTGTGCCCTGGCCATCCT GCTGGCAATTGTGAACTTCCAACATGGTGGATGTATTCATGTCACCAGCTCAGCATCCCAGAAAGGAGGG CGACTGGACCTCACCTGTACTTTGTGGCACAAGAAAGACGAAGCTGAGGGGCTAATACTCTTCTGGTGCA AAGACAATCCTTGGAACTGTTCCCCTGAGACCAGCTTAGAACAGCTTAGGGTTAAAAGGGATCCTGAGAC AGATGGCATCACTGAAAAGTCATCTCAGTTGGTGTTCACCATAGAACAAGCTACACCATCAGACAGTGGG ACCTACCAGTGCTGTGCCAGAAGCCAGAAACCAGAAATCTACATTCATGGCCACTTTCTCTCCGTTCTAG TCACAGGGAACCACACAGAGATAAGACAGAGACAAAGGTCACACCCTGACTTCAGCCATATCAACGGCAC TCTCAGTTCAGGCTTCCTGCAAGTAAAGGCTTGGGGGATGTTGGTCACCAGCCTGGTGGCCCTTCAAGCT CTATATACCTTGTGACAGAGAGAAAAAAAGACTTCAGAGGAAGGTACAGCGAGGTAAATCTGACAATGCG CAGAGAAGCCGGGTCCATAAAACGGATATACTCTGAACACTGGGGCCGGCCAGACGGTCAAGGGTAAAGG TGTTTGCCTGCCACATTGCAGGTCCAACCCGTGCACCCACATGGTGGAGGGAGAGAACTGACTCCCACAG GCTGTCCTCTGATCTCCACTGGGTGCCGTGCCTCCACCCCAGGCAACAAAAAAATCCCAAGAATCTAGCA GAACAGTTGGTATACCTCTGGATCTCCTTCCTGACTGCCAGAGCGAGGTTGGCTTCTCCCACCTCGGTGC CAATAAAGAAAACGTTTTGCAAATGTTGCTGATGTATAGTCCTTGAATGCCAGGTATGTTTTATACCACA GAATAATGTTTCCCCTCCACACAATAAAATAAGCAAGTTTTAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_018767 |
| Insert Size | 558 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC021596, AAH21596 |
| RefSeq Size | 1106 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 54215 |
| UniProt ID | O88875 |
| Gene Summary | CD160 antigen: Receptor on immune cells capable to deliver stimulatory or inhibitory signals that regulate cell activation and differentiation. Exists as a GPI-anchored and as a transmembrane form, each likely initiating distinct signaling pathways via phosphoinositol 3-kinase in activated NK cells and via LCK and CD247/CD3 zeta chain in activated T cells (By similarity). Receptor for both classical and non-classical MHC class I molecules (PubMed:16177084). Receptor or ligand for TNF superfamily member TNFRSF14, participating in bidirectional cell-cell contact signaling between antigen presenting cells and lymphocytes. Upon ligation of TNFRSF14, provides stimulatory signal to NK cells enhancing IFNG production and anti-tumor immune response (PubMed:25711213). On activated CD4+ T cells, interacts with TNFRSF14 and downregulates CD28 costimulatory signaling, restricting memory and alloantigen-specific immune response (By similarity). In the context of bacterial infection, acts as a ligand for TNFRSF14 on epithelial cells, triggering the production of antimicrobial proteins and proinflammatory cytokines (PubMed:22801499).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201707 | Cd160 (tGFP-tagged) - Mouse CD160 antigen (Cd160) |
CNY 2,850.00 |
|
| MG216467 | Cd160 (tGFP-tagged) - Mouse CD160 antigen (Cd160) transcript variant 2, (10ug) |
CNY 2,850.00 |
|
| MR216467 | Cd160 (Myc-DDK-tagged) - Mouse CD160 antigen (Cd160), transcript variant 2 |
CNY 2,400.00 |
|
| MR216467L3 | Lenti ORF clone of Cd160 (Myc-DDK-tagged) - Mouse CD160 antigen (Cd160), transcript variant 2 |
CNY 4,750.00 |
|
| MR216467L4 | Lenti ORF clone of Cd160 (mGFP-tagged) - Mouse CD160 antigen (Cd160), transcript variant 2 |
CNY 4,750.00 |
