0610038F07Rik (BC060090) Mouse Untagged Clone
CAT#: MC206891
0610038F07Rik (untagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361), (10ug)
CNY 3,230.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MGC61338 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206891 representing BC060090.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGTGGTCACCTTGATCCCGACGCTGGCGCGGGCACTGTCAAAGCACAGTCTGCTGTCTCCCTTG CCTAGTGTGACATCATTCAGACGCTTCTACAGAGGTGACAGCCCAACAGACTCTCAAAAAGACATGATT GAAATCCCTTTGCCTCCGTGGCAGGAGAGAACTGATGAATCCATAGAAACCAAAAGAGCCCGCTTACTC TATGAGAGCAGAAAGAGGGGGATGCTGGAGAACTGCATTCTCCTTAGCCTGTTTGCTAAAGAGTATCTG CACAACATGACAGAGAAGCAGCTGAACCTCTATGATCGCCTGATTAACGAGCCTAGCAATGACTGGGAT ATTTACTACTGGGCCACAGGTATGCCATATGCTGAGCTGCATCTTGGGATAATACGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC060090 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC060090 |
RefSeq Size | 3993 bp |
RefSeq ORF | 404 bp |
Locus ID | 66072 |
MW | 15.7 kDa |
Gene Summary | Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol. Required for flavinylation (covalent attachment of FAD) of the flavoprotein subunit SDHA of the SDH catalytic dimer.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200796 | 0610038F07Rik (tGFP-tagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361) |
CNY 2,850.00 |
|
MR200796 | 0610038F07Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361) |
CNY 1,200.00 |
|
MR200796L3 | Lenti ORF clone of 0610038F07Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361) |
CNY 4,750.00 |
|
MR200796L4 | Lenti ORF clone of 0610038F07Rik (mGFP-tagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361) |
CNY 4,750.00 |
其它0610038F07Rik产品