United States
Germany
Japan
United Kingdom
China
Arf1 (NM_007476) Mouse Untagged Clone
CAT＃: MC207033
Arf1 (untagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2, (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207033 representing NM_007476
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAATATCTTTGCAAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATTCTCATGGTGG GCCTGGATGCTGCAGGGAAGACAACAATTCTATACAAACTTAAGCTGGGCGAAATTGTGACCACCATTCC CACCATTGGTTTCAATGTGGAGACTGTTGAATACAAGAATATCAGCTTCACCGTGTGGGATGTGGGCGGC CAGGACAAGATCCGGCCGCTGTGGCGCCACTACTTCCAGAACACCCAAGGCTTGATCTTCGTAGTGGACA GCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAAGAGCTCATGAGGATGCTAGCTGAAGATGAGCTCCG AGATGCTGTTCTCTTGGTGTTTGCCAACAAGCAGGACCTCCCCAATGCCATGAATGCGGCCGAAATCACA GACAAGCTGGGGCTGCACTCTCTACGCCACAGGAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGG ACGGGCTCTATGAAGGACTAGATTGGCTGTCTAATCAGCTCCGGAACCAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007476 |
| Insert Size | 546 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_007476.3, NP_031502.1 |
| RefSeq Size | 1799 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 11840 |
| UniProt ID | P84078 |
| Gene Summary | GTP-binding protein involved in protein trafficking among different compartments (PubMed:11950392). Modulates vesicle budding and uncoating within the Golgi complex. Deactivation induces the redistribution of the entire Golgi complex to the endoplasmic reticulum, suggesting a crucial role in protein trafficking. In its GTP-bound form, its triggers the association with coat proteins with the Golgi membrane. The hydrolysis of ARF1-bound GTP, which is mediated by ARFGAPs proteins, is required for dissociation of coat proteins from Golgi membranes and vesicles. The GTP-bound form interacts with PICK1 to limit PICK1-mediated inhibition of Arp2/3 complex activity; the function is linked to AMPA receptor (AMPAR) trafficking, regulation of synaptic plasicity of excitatory synapses and spine shrinkage during long-term depression (LTD).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MC201696 | Arf1 (untagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2, (10ug) |
CNY 3,600.00 |
|
| MG201636 | Arf1 (tGFP-tagged) - Mouse ADP-ribosylation factor 1 (Arf1) |
CNY 2,850.00 |
|
| MG215275 | Arf1 (tGFP-tagged) - Mouse ADP-ribosylation factor 1 (Arf1) transcript variant 2, (10ug) |
CNY 2,850.00 |
|
| MR215275 | Arf1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2 |
CNY 3,840.00 |
|
| MR215275L3 | Lenti ORF clone of Arf1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2 |
CNY 4,750.00 |
|
| MR215275L4 | Lenti ORF clone of Arf1 (mGFP-tagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2 |
CNY 4,750.00 |
