Rnd1 (BC048531) Mouse Untagged Clone

CAT#: MC207173

Rnd1 (untagged) - Mouse Rho family GTPase 1 (cDNA clone MGC:58446 IMAGE:6535763), (10ug)



  "BC048531" in other vectors (4)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A830014L09Rik; Arhs
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC048531
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGAGAGACGGGCACCGCAGCCAGTGGTGGTCAGGTGTAAGCTCGTCCTGGTGGGAGACGTGCAGT
GTGGGAAGACGGCGATGTTACAGGTGCTAGCGAAAGACTGCTATCCCGAGACCTATGTGCCTACCGTGTT
TGAGAATTACACAGCCTGTTTGGAGACAGAGGAACAGAGAGTGGAGCTTAGTCTCTGGGACACCTCAGGT
TCTCCTTACTATGACAATGTTCGTCCACTCTGCTACAGCGACTCAGATGCGGTATTGCTGTGCTTTGACA
TCAGCCGTCCAGAGACCATGGACAGTGCACTCAAGAAGTGGAGAACAGAAATCCTAGACTACTGTCCCAG
CACACGTGTTTTGCTTATTGGCTGCAAGACAGATCTTCGAACAGACCTGAGCACTCTAATGGAACTGTCC
CACCAGAAGCAGGCACCCATCTCCTACGAGCAGGTGTGTGTGCATGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC048531
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC048531, AAH48531
RefSeq Size 889 bp
RefSeq ORF 506 bp
Locus ID 223881
Gene Summary Lacks intrinsic GTPase activity. Has a low affinity for GDP, and constitutively binds GTP. Controls rearrangements of the actin cytoskeleton. Induces the Rac-dependent neuritic process formation in part by disruption of the cortical actin filaments. Causes the formation of many neuritic processes from the cell body with disruption of the cortical actin filaments (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...