Apoc3 (NM_023114) Mouse Untagged Clone
CAT#: MC207231
Apoc3 (untagged) - Mouse apolipoprotein C-III (Apoc3), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | apo-CIII; apoC-III |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207231 representing NM_023114
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGCCCCGGACGCTCCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAG AGGGATCCTTGCTGCTGGGCTCTGTGCAGGGCTACATGGAACAAGCCTCCAAGACGGTCCAGGATGCGCT AAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATTCCTG AAAGGCTACTGGAGCAAGTTTACTGACAAGTTCACCGGCTTCTGGGATTCTAACCCTGAGGACCAACCAA CTCCAGCTATTGAGTCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023114 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021776, AAH21776 |
RefSeq Size | 537 bp |
RefSeq ORF | 300 bp |
Locus ID | 11814 |
UniProt ID | P33622 |
Gene Summary | This gene encodes an apolipoprotein which is the major protein component of very-low-density lipoproteins (VLDL) and a minor component of high-density lipoproteins (HDL). The encoded protein is thought to regulate the metabolism of triglyceride-rich lipoproteins and play a role in lipid storage and the mobilization of fat cells. This gene is clustered with three other apolipoprotein genes on chromosome 9 and is associated with coronary disease. Mice lacking this gene have lower levels of total cholesterol in the plasma. Mutations in the human genes causes hyperalphalipoproteinemia 2, a disorder of lipid metabolism which results in a favorable lipid profile (lower LDL-cholesterol, higher HDL-cholesterol and lower levels of serum triglycerides when fasting and after a meal). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200301 | Apoc3 (tGFP-tagged) - Mouse apolipoprotein C-III (Apoc3) |
CNY 2,850.00 |
|
MR200301 | Apoc3 (Myc-DDK-tagged) - Mouse apolipoprotein C-III (Apoc3) |
CNY 1,200.00 |
|
MR200301L3 | Lenti ORF clone of Apoc3 (Myc-DDK-tagged) - Mouse apolipoprotein C-III (Apoc3) |
CNY 4,750.00 |
|
MR200301L4 | Lenti ORF clone of Apoc3 (mGFP-tagged) - Mouse apolipoprotein C-III (Apoc3) |
CNY 4,750.00 |