Khdrbs3 (NM_010158) Mouse Untagged Clone

CAT#: MC207268

Khdrbs3 (untagged) - Mouse KH domain containing, RNA binding, signal transduction associated 3 (Khdrbs3), (10ug)



  "NM_010158" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Etle; Salp; SLM-2; Slm2; T-STAR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207268 representing NM_010158
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGAAGTACCTGCCGGAGCTGATGGCGGAGAAGGACTCTCTGGACCCCTCCTTCACGCACGCCC
TGCGCTTGGTGAACCGAGAAATAGAAAAGTTTCAAAAGGGAGAAGGCAAGGAGGAAGAGAAGTACATTGA
CGTGGTGATAAACAAGAACATGAAGCTGGGACAGAAGGTGCTGATTCCCGTGAAGCAGTTTCCCAAGTTC
AACTTTGTGGGGAAGCTTTTGGGTCCGCGTGGCAATTCCCTGAAGCGCTTACAAGAAGAAACGTTGACAA
AAATGTCCATCCTTGGCAAAGGTTCCATGAGAGACAAGGCAAAGGAGGAAGAGCTGAGGAAAAGTGGAGA
AGCGAAGTACTTTCACCTCAATGACGACCTGCACGTGCTCATTGAAGTGTTCGCACCCCCAGCAGAAGCA
TATGCCCGGATGGGGCACGCCTTGGAAGAGATCAAGAAATTCCTGATCCCTGACTATAATGATGAAATCA
GGCAAGCACAACTCCAGGAGTTAACATATTTGAATGGAGGTTCAGAAAATGCAGATGTCCCAGTGGTTCG
AGGGAAATCTACTTTGCGTACGAGAGGTGTAACTACACCAGCAATAACCAGGGGAAGAGGAGGAGTCACA
GCCAGGCCTGTTGCAGTTGGGGTACCACGTGGGACACCGACTCCCCGAGGAGTCCTTTCCACCCGAGGGC
CAGTGAGCCGGGGAAGAGGCCTTCTCACTCCCAGAGCAAGAGGTGTCCCCCCAACCGGATACAGACCTCC
CCCGCCACCCCCAACACAGGAGACCTATGGAGAGTATGACTATGACGATGGGTACGGTACTGCCTATGAT
GAGCAGAGCTATGACTCCTATGACAACAGCTACAGCACCCCAGCACAAAGTGCAGCTGATTACTACGATT
ATGGGCATGGACTCAGCGAGGACGCTTATGACTCCTATGGGCAAGAGGAATGGACTAACTCAAGACATAA
GGCTCCTTCGGCGAGGACGGCGAAGGGCGTCTACAGAGACCAGCCATATGGCAGATACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010158
Insert Size 1041 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_010158.2, NP_034288.2
RefSeq Size 1954 bp
RefSeq ORF 1041 bp
Locus ID 13992
UniProt ID Q9R226
Gene Summary RNA-binding protein that plays a role in the regulation of alternative splicing and influences mRNA splice site selection and exon inclusion. Binds preferentially to the 5'-[AU]UAAA-3' motif in vitro (PubMed:19457263). Binds optimally to RNA containing 5'-[AU]UAA-3' as a bipartite motif spaced by more than 15 nucleotides (By similarity). Binds poly(A). RNA-binding abilities are down-regulated by tyrosine kinase PTK6 (PubMed:15471878). Involved in splice site selection of vascular endothelial growth factor (By similarity). In vitro regulates CD44 alternative splicing by direct binding to purine-rich exonic enhancer (By similarity). Can regulate alternative splicing of neurexins NRXN1-3 in the laminin G-like domain 6 containing the evolutionary conserved neurexin alternative spliced segment 4 (AS4) involved in neurexin selective targeting to postsynaptic partners such as neuroligins and LRRTM family members. High concentrations in forebrain structures block splicing inclusion of NRXN1-3 AS4 exons while low concentrations favor their inclusion. Targeted, cell-type specific splicing regulation of NRXN1 at AS4 is involved in neuronal glutamatergic synapse function and plasticity and is linked to behavioral aspects (PubMed:22196734, PubMed:23637638, PubMed:24469635, PubMed:27174676). Regulates expression of KHDRBS2/SLIM-1 in defined neuron populations in the hippocampus by modifying its alternative splicing resulting in a transcript predicted to undergo nonsense-mediated decay (PubMed:25505328). Can bind FABP9 mRNA (PubMed:19916944). May play a role as a negative regulator of cell growth. Inhibits cell proliferation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...