United States
Germany
Japan
United Kingdom
China
Timm10b (NM_019502) Mouse Untagged Clone
CAT＃: MC207282
Timm10b (untagged) - Mouse fractured callus expressed transcript 1 (Fxc1), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Fxc1; Tim9b; Tim10b |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207282 representing NM_019502
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCAGCAGCAGCAGCAACTGAGAAACTTGCGAGACTTCCTGTTGGTCTACAATCGGATGACAGAAC TGTGTTTCCAGCGCTGTGTGCCCAGCCTGCACCACCGAGCTCTGGACGCTGAGGAGGAGGCCTGCCTGCA CAGCTGTGCTGGGAAACTCATCCATTCTAACCACCGCCTCATGGCCGCTTACGTGCACCTCATGCCCGCC CTGGTCCAGCGCCGCATCGCGGACTACGAGGCTGCCTCGGCCGCGCCAGGTATTCCTGCAGAACAGACCA GAGACTCGCCATCAGGCAGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019502 |
| Insert Size | 303 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019502.2, NP_062375.1 |
| RefSeq Size | 1013 bp |
| RefSeq ORF | 303 bp |
| Locus ID | 14356 |
| UniProt ID | Q9WV96 |
| Gene Summary | Component of the TIM22 complex, a complex that mediates the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. The TIM22 complex forms a twin-pore translocase that uses the membrane potential as the external driving force. In the TIM22 complex, it may act as a docking point for the soluble 70 kDa complex that guides the target proteins in transit through the aqueous mitochondrial intermembrane space.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6), as well as variants 4 and 5, encodes isoform d. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200306 | Timm10b (tGFP-tagged) - Mouse fractured callus expressed transcript 1 (Fxc1) |
CNY 2,850.00 |
|
| MR200306 | Timm10b (Myc-DDK-tagged) - Mouse fractured callus expressed transcript 1 (Fxc1) |
CNY 1,200.00 |
|
| MR200306L3 | Lenti ORF clone of Timm10b (Myc-DDK-tagged) - Mouse fractured callus expressed transcript 1 (Fxc1) |
CNY 4,750.00 |
|
| MR200306L4 | Lenti ORF clone of Timm10b (mGFP-tagged) - Mouse fractured callus expressed transcript 1 (Fxc1) |
CNY 4,750.00 |
其它Timm10b产品
