United States
Germany
Japan
United Kingdom
China
Ctdsp2 (NM_146012) Mouse Untagged Clone
CAT＃: MC207494
Ctdsp2 (untagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2), transcript variant b, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI586070; D10Ertd73e; OS-4; OS4; SCP2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207494 representing NM_146012
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGAGCTCTTCGAATGTGTTCTCTTCACTGCCAGCTTGGCCAAGTATGCTGACCCTGTGACTGATC TCCTGGACCGGTGCGGGGTGTTCCGGGCCCGCCTGTTCCGAGAGGCTTGTGTGTTCCACCAGGGCTGCTA TGTCAAGGACCTCAGCCGCCTGGGAAGGGACCTGAGGAAAACTGTCATCCTGGACAACTCCCCTGCATCT TACATCTTCCACCCAGAAAATGCAGTGCCTGTGCAGTCCTGGTTTGATGACATGGCAGATACAGAGTTGC TGAACCTGATTCCAGTCTTCGAGGAGCTAAGTGGAACTGATGATGTCTACACCAGCCTTGGGCAGCTGCG GGCCCCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_146012 |
| Insert Size | 360 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_146012.2, NP_666124.1 |
| RefSeq Size | 4136 bp |
| RefSeq ORF | 360 bp |
| Locus ID | 52468 |
| UniProt ID | Q8BX07 |
| Gene Summary | Preferentially catalyzes the dephosphorylation of 'Ser-5' within the tandem 7 residue repeats in the C-terminal domain (CTD) of the largest RNA polymerase II subunit POLR2A. Negatively regulates RNA polymerase II transcription, possibly by controlling the transition from initiation/capping to processive transcript elongation. Recruited by REST to neuronal genes that contain RE-1 elements, leading to neuronal gene silencing in non-neuronal cells (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (b) differs in the 5' UTR, lacks multiple 5' coding exons, and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200569 | Ctdsp2 (tGFP-tagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2) |
CNY 2,850.00 |
|
| MR200569 | Ctdsp2 (Myc-DDK-tagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2), transcript variant b |
CNY 1,200.00 |
|
| MR200569L3 | Lenti ORF clone of Ctdsp2 (Myc-DDK-tagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2), transcript variant b |
CNY 4,750.00 |
|
| MR200569L4 | Lenti ORF clone of Ctdsp2 (mGFP-tagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2), transcript variant b |
CNY 4,750.00 |
