United States
Germany
Japan
United Kingdom
China
Ube2w (NM_025773) Mouse Untagged Clone
CAT＃: MC207595
Ube2w (untagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6130401J04Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207595 representing NM_025773
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGGGCCCCCGCGGCGTGACGCGAGCACGGCGGCTCCGCCCCCTGCGTCTCGGGCCTCGCTGGCCTT GGGGGGATGGTTTCATCATGGCGTCAATGCAGAAACGACTACAAAAAGAACTGTTGGCTTTGCAGAATGA CCCACCTCCTGGAATGACTTTAAATGAAAAGAGTGTTCAGAATTCAATCACGCAGTGGATCGTAGACATG GAAGGTGCACCAGGAACCTTATATGAAGGGGAAAAATTTCAACTTTTGTTTAAATTTAGTAGTCGATACC CTTTTGACTCTCCTCAGGTCATGTTTACTGGTGAAAATATTCCCATTCATCCTCATGTGTATAGCAATGG TCATATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCGGCGCTCTCAGTGCAGTCAGTCTGTCTCAGC ATTATCAGCATGCTTTCCAGCTGCAAAGAAAAGAGACGACCACCAGATAATTCCTTTTATGTGCGAACAT GTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGATGACACTTGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_025773 |
| Insert Size | 543 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_025773.3, NP_080049.2 |
| RefSeq Size | 3139 bp |
| RefSeq ORF | 543 bp |
| Locus ID | 66799 |
| UniProt ID | Q8VDW4 |
| Gene Summary | Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Specifically monoubiquitinates the N-terminus of various substrates, including ATXN3, MAPT/TAU, POLR2H/RPB8 and STUB1/CHIP, by recognizing backbone atoms of disordered N-termini (PubMed:21855799, PubMed:21229326). Involved in degradation of misfolded chaperone substrates by mediating monoubiquitination of STUB1/CHIP, leading to recruitment of ATXN3 to monoubiquitinated STUB1/CHIP, and restriction of the length of ubiquitin chain attached to STUB1/CHIP substrates by ATXN3 (PubMed:21855799). After UV irradiation, but not after mitomycin-C (MMC) treatment, acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway (PubMed:21229326). In vitro catalyzes 'Lys-11'-linked polyubiquitination. UBE2W-catalyzed ubiquitination occurs also in the presence of inactive RING/U-box type E3s, i.e. lacking the active site cysteine residues to form thioester bonds with ubiquitin, or even in the absence of E3, albeit at a slower rate (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by transcript and conservation data. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201089 | Ube2w (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w) |
CNY 2,850.00 |
|
| MR201089 | Ube2w (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w) |
CNY 1,200.00 |
|
| MR201089L3 | Lenti ORF clone of Ube2w (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w) |
CNY 4,750.00 |
|
| MR201089L4 | Lenti ORF clone of Ube2w (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w) |
CNY 4,750.00 |
