Ost4 (NM_001134692) Mouse Untagged Clone
CAT#: MC207634
Ost4 (untagged) - Mouse oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 2, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310016E02Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207634 representing NM_001134692
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCACGGACGTGCAGCTCGCCATCTTCGCCAACATGCTGGGCGTGTCGCTTTTCTTGCTTGTGGTCC TCTATCACTACGTGGCAGTAAACAACCCCAAGAAGCAGGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134692 |
Insert Size | 114 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134692.2, NP_001128164.1 |
RefSeq Size | 657 bp |
RefSeq ORF | 114 bp |
Locus ID | 67695 |
UniProt ID | Q99LX8 |
Gene Summary | Subunit of the oligosaccharyl transferase (OST) complex that catalyzes the initial transfer of a defined glycan (Glc(3)Man(9)GlcNAc(2) in eukaryotes) from the lipid carrier dolichol-pyrophosphate to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains, the first step in protein N-glycosylation. N-glycosylation occurs cotranslationally and the complex associates with the Sec61 complex at the channel-forming translocon complex that mediates protein translocation across the endoplasmic reticulum (ER). All subunits are required for a maximal enzyme activity. Specifically involved in maintaining stability of STT3A-containing OST complexes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200006 | Ost4 (Myc-DDK-tagged) - Mouse oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 2 |
CNY 1,200.00 |
|
MR200006L3 | Lenti ORF clone of Ost4 (Myc-DDK-tagged) - Mouse oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 2 |
CNY 4,750.00 |
|
MR200006L4 | Lenti ORF clone of Ost4 (mGFP-tagged) - Mouse oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 2 |
CNY 4,750.00 |