Endov (NM_177394) Mouse Untagged Clone

CAT#: MC207963

Endov (untagged) - Mouse RIKEN cDNA A730011L01 gene (A730011L01Rik), transcript variant 2, (10ug)



  "NM_177394" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Endov Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A730011L01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207963 representing NM_177394
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTGGCCTGAAGGCCCCCTATGTGTCAGGCTTCCTGGCCTTCCGAGAGGTCCCTTTCCTGGTGGAGT
TGGTACAGCGGCTGCAAGAGAAGGAACCAGATCTCATGCCCCAGGTCGTTCTTGTGGATGGAAACGGGGT
GCTTCACCAACGAGGCTTCGGGGTGGCCTGCCACCTTGGTGTCCTTACAGAGCTGCCATGCATCGGGGTG
GCCAAGAAGCTCCTGCAGGTGGATGGACTGGAGAACAATGCTCTGCACAAGGAGAAGATTGTGCTCCTGC
AGGCCGGAGGAGACACATTTCCTCTGATAGGCAGCTCTGGGACTGTCCTGGGAATGGCCCTGAGGAGCCA
TGACCACAGCACCAAGCCCCTCTATGTCTCTGTGGGCCACAGAATAAGCCTGGAGGTCGCTGTGCGCCTC
ACCCACCACTGCTGTAGGTTCCGGATCCCAGAACCTATACGCCAGGCTGACATCCGCTCTCGAGAGTACA
TCCGAAGGACTCTAGGGCAGCTTGGGGTGGCTCCTGCACAGAGAAAGGACAGGAGCCAGAAAGAGCAGAG
GCCAAATGCATGCCCCCAAGGAGGCCCAGGAGCACTTGCAGATCAAGGCAGGCCTCCTGAATGCGACGGC
AGAGACTCCAGCTCAGACCGGAAAGCCCCCGAGCCAGGCTTCCAGGAGCAGAAGGACCAGCAGTTGGAGG
GAACCGGGCATCAGGAAGACTCGGACCTCTGGCCTCCTTCTCCAGCCTGGGTACAGTCACCACCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177394
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177394.3, NP_796368.1
RefSeq Size 5164 bp
RefSeq ORF 768 bp
Locus ID 338371
UniProt ID Q8C9A2
Gene Summary Endoribonuclease that specifically cleaves inosine-containing RNAs: cleaves RNA at the second phosphodiester bond 3' to inosine. Has strong preference for single-stranded RNAs (ssRNAs) toward double-stranded RNAs (dsRNAs). Cleaves mRNAs and tRNAs containing inosine. Also able to cleave structure-specific dsRNA substrates containing the specific sites 5'-IIUI-3' and 5'-UIUU-3'. Inosine is present in a number of RNAs following editing; the function of inosine-specific endoribonuclease is still unclear: it could either play a regulatory role in edited RNAs, or be involved in antiviral response by removing the hyperedited long viral dsRNA genome that has undergone A-to-I editing. Binds branched DNA structures (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) represents an alternate 5' splice pattern and uses a downstream start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...