Ufd1 (NM_011672) Mouse Untagged Clone

CAT#: MC208050

Ufd1l (untagged) - Mouse ubiquitin fusion degradation 1 like (Ufd1l), transcript variant 1, (10ug)



  "NM_011672" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ufd1; Ufd1l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208050 representing NM_011672
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTTCTTTCAACATGTTTGACCACCCGATTCCCCGGGTCTTCCAGAACCGCTTCTCCACGCAGTACC
GCTGCTTCTCCGTGTCCATGCTAGCAGGGCCTAATGACAGGTCAGATGTGGAGAAAGGAGGGAAGATAAT
TATGCCACCCTCAGCCCTCGATCAACTCAGCCGGCTCAACATTACCTATCCTATGCTGTTTAAATTGACC
AATAAGAATTCAGATCGGATGACACACTGCGGTGTACTGGAGTTTGTTGCTGATGAAGGCATCTGTTACC
TCCCCCACTGGATGATGCAGAATTTGCTGTTGGAGGAAGGGGGCCTGGTTCAGGTGGAAAGTGTCAACCT
CCAAGTGGCGACCTACTCTAAGTTCCAGCCTCAGAGCCCAGACTTCCTGGATATTACCAACCCTAAAGCG
GTATTAGAAAATGCATTGAGAAACTTCGCCTGTCTGACGACTGGAGATGTGATTGCTATCAACTACAATG
AGAAGATCTATGAGCTGCGGGTGATGGAGACCAAACCTGACAAGGCTGTATCCATTATTGAATGTGACAT
GAATGTGGATTTTGATGCTCCCTTGGGATACAAAGAACCAGAAAGACCAGTGCAGCATGAGGAGTCAATA
GAGGGAGAAGCTGACCACAGTGGCTATGCCGGAGAGGTGGGCTTCCGTGCCTTCTCTGGTTCTGGGAATA
GACTGGATGGGAAGAAAAAAGGGGTTGAGCCCAGTCCCTCCCCAATCAAGCCTGGAGACATCAAAAGAGG
AATTCCTAATTACGAATTTAAGCTTGGTAAGATCACTTTCATCAGAAATTCACGTCCATTGGTCAAAAAG
GTTGAAGAGGATGAAGCTGGAGGCAGATTCATTGCTTTCTCTGGAGAAGGACAGTCACTGCGTAAGAAGG
GAAGAAAGCCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011672
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011672.4, NP_035802.3
RefSeq Size 1996 bp
RefSeq ORF 924 bp
Locus ID 22230
UniProt ID P70362
Gene Summary Essential component of the ubiquitin-dependent proteolytic pathway which degrades ubiquitin fusion proteins. The ternary complex containing UFD1, VCP and NPLOC4 binds ubiquitinated proteins and is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome. The NPLOC4-UFD1-VCP complex regulates spindle disassembly at the end of mitosis and is necessary for the formation of a closed nuclear envelope. It may be involved in the development of some ectoderm-derived structures (By similarity). Acts as a negative regulator of type I interferon production via the complex formed with VCP and NPLOC4, which binds to DDX58/RIG-I and recruits RNF125 to promote ubiquitination and degradation of DDX58/RIG-I (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and is the protein-coding transcript.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...