Bcl2 (NM_009741) Mouse Untagged Clone

CAT#: MC208178

Bcl2 (untagged) - Mouse B-cell leukemia/lymphoma 2 (Bcl2), transcript variant 1, (10ug)



  "NM_009741" in other vectors (3)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Bcl2(Isoform Beta) Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW986256; Bcl-; Bcl-2; C430015F12Rik; D630044D05Rik; D830018M01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208178 representing NM_009741
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCAAGCCGGGAGAACAGGGTATGATAACCGGGAGATCGTGATGAAGTACATACATTATAAGCTGT
CACAGAGGGGCTACGAGTGGGATGCTGGAGATGCGGACGCGGCGCCCCTGGGGGCTGCCCCCACCCCTGG
CATCTTCTCCTTCCAGCCTGAGAGCAACCCAATGCCCGCTGTGCACCGGGACATGGCTGCCAGGACGTCT
CCTCTCAGGCCCCTCGTTGCCACCGCTGGGCCTGCGCTCAGCCCTGTGCCACCTGTGGTCCATCTGACCC
TCCGCCGGGCTGGGGATGACTTCTCTCGTCGCTACCGTCGTGACTTCGCAGAGATGTCCAGTCAGCTGCA
CCTGACGCCCTTCACCGCGAGGGGACGCTTTGCCACGGTGGTGGAGGAACTCTTCAGGGATGGGGTGAAC
TGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACAGGGAGATGT
CACCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCATCTGCACACCTGGATCCA
GGATAACGGAGGCTGGGATGCCTTTGTGGAACTATATGGCCCCAGCATGCGACCTCTGTTTGATTTCTCC
TGGCTGTCTCTGAAGACCCTGCTCAGCCTGGCCCTGGTCGGGGCCTGCATCACTCTGGGTGCATACCTGG
GCCACAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_009741
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009741.5, NP_033871.2
RefSeq Size 7224 bp
RefSeq ORF 711 bp
Locus ID 12043
UniProt ID P10417
Gene Summary This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...