Socs3 (NM_007707) Mouse Untagged Clone

CAT#: MC208284

Socs3 (untagged) - Mouse suppressor of cytokine signaling 3 (Socs3), (10ug)



  "NM_007707" in other vectors (6)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cis3; Cish3; EF-10; Ef10; SSI-3; Ssi3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208284 representing NM_007707
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTGCGCCTCAAGA
CCTTCAGCTCCAAAAGCGAGTACCAGCTGGTGGTGAACGCCGTGCGCAAGCTGCAGGAGAGCGGATTCTA
CTGGAGCGCCGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGCGCCGAGCCCGCGGGCACCTTTCTTATC
CGCGACAGCTCGGACCAGCGCCACTTCTTCACGTTGAGCGTCAAGACCCAGTCGGGGACCAAGAACCTAC
GCATCCAGTGTGAGGGGGGCAGCTTTTCGCTGCAGAGTGACCCCCGAAGCACGCAGCCAGTTCCCCGCTT
CGACTGTGTACTCAAGCTGGTGCACCACTACATGCCGCCTCCAGGGACCCCCTCCTTTTCTTTGCCACCC
ACGGAACCCTCGTCCGAAGTTCCGGAGCAGCCACCTGCCCAGGCACTCCCCGGGAGTACCCCCAAGAGAG
CTTACTACATCTATTCTGGGGGCGAGAAGATTCCGCTGGTACTGAGCCGACCTCTCTCCTCCAACGTGGC
CACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTG
CCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007707
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007707.3, NP_031733.1
RefSeq Size 2742 bp
RefSeq ORF 678 bp
Locus ID 12702
UniProt ID O35718
Gene Summary SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 is involved in negative regulation of cytokines that signal through the JAK/STAT pathway. Inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. Suppresses fetal liver erythropoiesis. Regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. Regulates IL-6 signaling in vivo. Probable substrate-recognition component of a SCF-like ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). Seems to recognize IL6ST.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...