Cort (NM_007745) Mouse Untagged Clone
CAT#: MC208307
Cort (untagged) - Mouse cortistatin (Cort), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CS; CST; PC; PCST |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208307 representing NM_007745
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGGTGGCCGAGGCACAGGAGGCAAGTGGCCCTCAGCCTTCGGGCTGCTGCTGCTCTGGGGGGTCG CAGCCTCCGCCCTTCCCCTGGAGAGTGGCCCTACTGGCCAGGACAGTGTGCAGGAAGCCACCGAGGGGAG GAGCGGCCTTCTGACTTTCCTTGCCTGGTGGCACGAGTGGGCTTCCCAAGCCAGCTCCAGCACCCCCGTC GGAGGGGGTACCCCCGGGCTGTCCAAGAGCCAGGAAAGGCCACCCCCCCAACAGCCCCCACACCTGGATA AAAAGCCCTGCAAGAACTTCTTCTGGAAAACCTTCTCCTCGTGCAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007745 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007745.4, NP_031771.1 |
RefSeq Size | 690 bp |
RefSeq ORF | 330 bp |
Locus ID | 12854 |
UniProt ID | P56469 |
Gene Summary | This gene encodes a member of the somatostatin family of multifunctional peptides attributed with neurohormone, neurotransmitter/modulator and autocrine/paracrine actions. The encoded preproprotein undergoes proteolytic processing to generate a mature functional peptide that can bind to somatostatin receptors. Mice lacking the encoded protein exhibit elevated levels of growth hormone in the plasma without major changes in somatic growth and have exacerbated nociceptive responses to neuropathic and inflammatory pain sensitization. Transgenic mice overexpressing the encoded protein in neurons do not express long-term potentiation in the dentate gyrus and exhibit deficits in synaptic plasticity and learning. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215280 | Cort (tGFP-tagged) - Mouse cortistatin (Cort), (10ug) |
CNY 2,800.00 |
|
MR215280 | Cort (Myc-DDK-tagged) - Mouse cortistatin (Cort) |
CNY 1,200.00 |
|
MR215280L3 | Lenti ORF clone of Cort (Myc-DDK-tagged) - Mouse cortistatin (Cort) |
CNY 4,750.00 |
|
MR215280L4 | Lenti ORF clone of Cort (mGFP-tagged) - Mouse cortistatin (Cort) |
CNY 4,750.00 |