Csnk2b (NM_009975) Mouse Untagged Clone

CAT#: MC208346

Csnk2b (untagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b), (10ug)



  "NM_009975" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Csnk2b Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CK II beta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208346 representing NM_009975
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTAGCTCTGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTG
AGGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCG
ACAAGCTCTGGACATGATCTTAGACCTGGAACCTGATGAAGAGCTGGAAGACAACCCCAACCAGAGCGAC
TTGATCGAACAGGCAGCTGAGATGCTTTATGGGTTGATCCACGCCCGCTACATCCTCACCAACCGAGGCA
TCGCACAAATGTTGGAAAAGTACCAGCAGGGAGACTTTGGCTACTGTCCTCGTGTATACTGTGAGAACCA
GCCAATGCTTCCTATCGGCCTTTCAGACATCCCAGGCGAGGCCATGGTGAAACTCTACTGCCCCAAGTGC
ATGGACGTGTACACACCCAAGTCCTCCAGACACCACCACACGGACGGCGCATACTTCGGCACTGGTTTCC
CTCACATGCTCTTCATGGTGCATCCAGAGTACCGGCCCAAGCGACCTGCCAACCAGTTTGTACCCAGGCT
CTATGGTTTCAAGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCA
GTCAAGACTATTCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009975
Insert Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009975.3, NP_034105.1
RefSeq Size 970 bp
RefSeq ORF 648 bp
Locus ID 13001
UniProt ID P67871
Gene Summary This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...