Epm2a (NM_010146) Mouse Untagged Clone

CAT#: MC208444

Epm2a (untagged) - Mouse epilepsy, progressive myoclonic epilepsy, type 2 gene alpha (Epm2a), (10ug)



  "NM_010146" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms TcrbK)TG-BFlv; Tg(TcraK; TG-B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208444 representing NM_010146
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCTTCCGCTTCGGCGTGGTGGTGCCGCCCGCGGTGGCCGGCGCTCGGCAGGAGCTGCTGCTCGCCG
GCTCGCGGCCCGAGTTAGGGCGCTGGGAGCCGCACGGCGCCGTGCGTCTCAGGCCCGCGGGTACCGCGGC
GGGCGCCGCTGCGCTGGCGCTGCAGGAGCCCGGCCTGTGGCTCGCCGAGGTGGAGCTGGAGGCGTACGAG
GAGGCCGGCGGGGCGGAGCCGGGCCGCGTTGACACGTTCTGGTACAAGTTCCTGCAGCGCGAGCCTGGAG
GCGAGCTGCACTGGGAAGGAAATGGACCTCACCATGACCGTTGCTGCACATATAATGAGGACAACTTGGT
GGATGGTGTTTATTGTCTCCCAGTAGGACACTGGATTGAGGCCACTGGGCACACCAATGAAATGAAGCAC
ACAACAGACTTCTATTTTAATATTGCTGGCCACCAAGCCATGCACTATTCAAGAATTCTACCAAATATCT
GGCTGGGTAGCTGCCCTCGCCAACTGGAACATGTGACCATCAAACTGAAGCATGAACTGGGAGTTACAGC
TGTCATGAATTTCCAGACTGAATGGGATATCATCCAGAATTCTTCAGGCTGCAACCGCTACCCTGAACCC
ATGACTCCAGACACCATGATGAAGCTGTATAAGGAAGAAGGCTTGTCCTACATCTGGATGCCCACTCCAG
ACATGAGCACTGAGGGCCGAGTGCAGATGCTGCCACAGGCTGTGTGTCTCCTGCACGCGCTTCTGGAGAA
TGGACACACGGTGTATGTCCACTGCAACGCTGGCGTGGGTCGCTCCACAGCTGCAGTGTGCGGCTGGCTC
CACTATGTGATTGGCTGGAATCTGCGCAAGGTGCAGTACTTCATCATGGCCAAGAGGCCTGCGGTCTACA
TTGACGAGGACGCTTTGGCTCAAGCACAACAAGACTTTTCTCAGAAGTTCGGGAAGGTTCACTCTTCCAT
ATGCGCTTTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010146
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010146.2, NP_034276.2
RefSeq Size 1079 bp
RefSeq ORF 993 bp
Locus ID 13853
UniProt ID Q9WUA5
Gene Summary Plays an important role in preventing glycogen hyperphosphorylation and the formation of insoluble aggregates, via its activity as glycogen phosphatase, and by promoting the ubiquitination of proteins involved in glycogen metabolism via its interaction with the E3 ubiquitin ligase NHLRC1/malin (PubMed:18040046, PubMed:18852261, PubMed:19036738, PubMed:23663739, PubMed:24430976, PubMed:24068615). Dephosphorylates phosphotyrosine and synthetic substrates, such as para-nitrophenylphosphate (pNPP), and has low activity with phosphoserine and phosphothreonine substrates (in vitro) (PubMed:16971387, PubMed:24430976). Has also been shown to dephosphorylate MAPT (PubMed:19542233). Shows strong phosphatase activity towards complex carbohydrates in vitro, avoiding glycogen hyperphosphorylation which is associated with reduced branching and formation of insoluble aggregates (PubMed:18040046, PubMed:18852261, PubMed:23663739). Forms a complex with NHLRC1/malin and HSP70, which suppresses the cellular toxicity of misfolded proteins by promoting their degradation through the ubiquitin-proteasome system (UPS) (PubMed:19036738, PubMed:24068615). Acts as a scaffold protein to facilitate PPP1R3C/PTG ubiquitination by NHLRC1/malin. Also promotes proteasome-independent protein degradation through the macroautophagy pathway (PubMed:20453062).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...