United States
Germany
Japan
United Kingdom
China
Hand2 (NM_010402) Mouse Untagged Clone
CAT＃: MC208647
Hand2 (untagged) - Mouse heart and neural crest derivatives expressed transcript 2 (Hand2), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI225906; AI661148; bHLHa26; dHAND; Ehand2; Hed; Th2; Thing2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208647 representing NM_010402
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTCTGGTGGGGGGCTTTCCCCACCACCCCGTGGTGCACCATGAGGGCTACCCATTCGCCGCAGCCG CCGCCGCCGCTGCCGCCGCCGCCGCCAGCCGCTGCAGCCACGAGGAGAACCCCTACTTCCACGGCTGGCT TATTGGCCACCCGGAGATGTCGCCCCCCGACTACAGTATGGCCCTGTCCTACAGCCCCGAGTACGCCAGC GGTGCCGCGGGCCTGGACCACTCCCATTATGGGGGAGTGCCGCCCGGCGCCGGGCCTCCCGGCCTGGGGG GGCCGCGCCCGGTGAAGCGCCGGGGCACCGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAG CGCCTTCGCCGAGCTGCGCGAGTGCATCCCCAACGTGCCCGCCGACACCAAACTCTCCAAGATCAAGACA CTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGATCTGCTGGCCAAGGACGACCAGAACGGAGAGG CGGAGGCCTTCAAGGCGGAGATCAAGAAGACCGACGTGAAAGAGGAGAAGAGGAAGAAAGAGCTGAATGA GATCTTGAAAAGCACAGTGAGCAGCAACGACAAGAAAACCAAAGGCCGGACAGGCTGGCCACAGCACGTC TGGGCCCTGGAGCTCAAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_010402 |
| Insert Size | 654 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_010402.4, NP_034532.3 |
| RefSeq Size | 2235 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 15111 |
| UniProt ID | Q61039 |
| Gene Summary | Essential for cardiac morphogenesis, particularly for the formation of the right ventricle and of the aortic arch arteries. Required for vascular development and regulation of angiogenesis, possibly through a VEGF signaling pathway. Plays also an important role in limb development, particularly in the establishment of anterior-posterior polarization, acting as an upstream regulator of sonic hedgehog (SHH) induction in the limb bud. Is involved in the development of branchial arches, which give rise to unique structures in the head and neck. Binds DNA on E-box consensus sequence 5'-CANNTG-3'.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227003 | Hand2 (tGFP-tagged) - Mouse heart and neural crest derivatives expressed transcript 2 (Hand2), (10ug) |
CNY 5,200.00 |
|
| MR227003 | Hand2 (Myc-DDK-tagged) - Mouse heart and neural crest derivatives expressed transcript 2 (Hand2) |
CNY 3,600.00 |
|
| MR227003L3 | Lenti ORF clone of Hand2 (Myc-DDK-tagged) - Mouse heart and neural crest derivatives expressed transcript 2 (Hand2) |
CNY 5,890.00 |
|
| MR227003L4 | Lenti ORF clone of Hand2 (mGFP-tagged) - Mouse heart and neural crest derivatives expressed transcript 2 (Hand2) |
CNY 5,890.00 |
