United States
Germany
Japan
United Kingdom
China
Oxt (NM_011025) Mouse Untagged Clone
CAT＃: MC209130
Oxt (untagged) - Mouse oxytocin (Oxt), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | OT; Ox; Oxy |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209130 representing NM_011025
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTGCCCCAGTCTCGCTTGCTGCCTGCTTGGCTTACTGGCTCTGACCTCGGCCTGCTACATCCAGA ACTGCCCCCTGGGCGGCAAGAGGGCTGTGCTGGACCTGGATATGCGCAAGTGTCTCCCCTGCGGCCCGGG CGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGAGCTGGGCTGCTTCGTGGGCACCGCC GAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCTTCGCCCTGCCAGTCTGGCCAGAAGCCCTGCGGGA GCGGAGGCCGCTGCGCCGCCACAGGCATCTGCTGCAGCCCGGATGGCTGCCGCACAGACCCCGCCTGCGA CCCTGAGTCTGCCTTCTCGGAGCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011025 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011025.4, NP_035155.1 |
| RefSeq Size | 555 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 18429 |
| UniProt ID | P35454 |
| Gene Summary | This gene encodes a preproprotein that is processed to produce oxytocin and neurophysin 1. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin 1. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation, the stress response and complex sexual and maternal behavior, as well as in the regulation of water excretion, salt appetite, blood pressure and cardiovascular functions. Deletion of this gene in mouse reduces bone formation resulting in osteoporosis. [provided by RefSeq, Dec 2013] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG225611 | Oxt (tGFP-tagged) - Mouse oxytocin (Oxt), (10ug) |
CNY 2,850.00 |
|
| MR225611 | Oxt (Myc-DDK-tagged) - Mouse oxytocin (Oxt) |
CNY 1,200.00 |
|
| MR225611L3 | Lenti ORF clone of Oxt (Myc-DDK-tagged) - Mouse oxytocin (Oxt) |
CNY 4,750.00 |
|
| MR225611L4 | Lenti ORF clone of Oxt (mGFP-tagged) - Mouse oxytocin (Oxt) |
CNY 4,750.00 |
