Purb (NM_011221) Mouse Untagged Clone

CAT#: MC209267

Purb (untagged) - Mouse purine rich element binding protein B (Purb), (10ug)



  "NM_011221" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PURB Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310015K15Rik; AA114818; Cager-2; D11Bwg0414e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209267 representing NM_011221
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGACGGCGACAGCGGCAGCGAGCGCGGCGGTGGCGGCGGCGGCGGCGGCGGGCCCGGCGGCTTCC
AGCCCGCGCCCCGCGGCGGCGGCGGCGGCGGTGGCGGGCCGGGCGGCGAGCAGGAGACGCAGGAGCTGGC
CTCGAAGCGGCTGGACATCCAGAACAAGCGCTTCTACCTGGACGTGAAGCAGAACGCCAAGGGCCGCTTC
CTCAAGATCGCCGAGGTGGGCGCGGGCGGCTCCAAGAGCCGCCTCACGCTGTCGATGGCGGTGGCCGCCG
AGTTCCGCGACTCGCTGGGCGACTTCATCGAGCACTACGCGCAGCTGGGTCCCAGCAGCCCCGAGCAGCT
GGCGGCGGGCGCCGAGGAGGGCGGCGGGCCGCGCCGCGCGCTCAAGAGCGAGTTCCTGGTGCGCGAGAAC
CGCAAGTACTACCTGGACCTCAAGGAGAACCAGCGCGGCCGCTTCCTGCGCATCCGCCAGACGGTGAACC
GCGGCGGCGGCGGCTTCGGCGGGGGGCCCGGGCCCGGCGGCCTGCAGAGCGGCCAGACCATCGCGCTGCC
CGCGCAGGGCCTCATCGAGTTCCGCGACGCGCTCGCCAAGCTCATCGACGACTACGGGGGCGACGAGGAC
GAGCTGGCCGGCGGCCCGGGAGGCGGCGCCGGCGGCCCCGGGGGCGGCCTGTACGGAGAGCTCCCGGAGG
GCACCTCCATCACCGTGGACTCGAAGCGCTTCTTCTTCGACGTCGGCTGCAACAAGTACGGGGTGTTCCT
GCGAGTGAGCGAGGTGAAGCCGTCCTACCGCAATGCCATCACCGTGCCCTTCAAGGCCTGGGGCAAGTTT
GGAGGCGCCTTCTGTCGGTATGCAGATGAAATGAAAGAGATCCAGGAGCGACAGAGGGATAAGCTTTACG
AGCGACGCGGCGGGGGCAGCGGTGGCGGCGACGAGTCGGAGGGTGAGGAAGTGGATGAGGATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011221
Insert Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011221.3, NP_035351.1
RefSeq Size 8478 bp
RefSeq ORF 975 bp
Locus ID 19291
UniProt ID O35295
Gene Summary Has capacity to bind repeated elements in single-stranded DNA such as the purine-rich single strand of the PUR element located upstream of the MYC gene. Participates in transcriptional and translational regulation of alpha-MHC expression in cardiac myocytes by binding to the purine-rich negative regulatory (PNR) element. Modulates constitutive liver galectin-3 gene transcription by binding to its promoter. May play a role in the dendritic transport of a subset of mRNAs (By similarity). Plays a role in the control of vascular smooth muscle (VSM) alpha-actin gene transcription as repressor in myoblasts and fibroblasts.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...