Usf1 (NM_009480) Mouse Untagged Clone
CAT#: MC209623
Usf1 (untagged) - Mouse upstream transcription factor 1 (Usf1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb1; bHLHb11 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209623 representing NM_009480
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGGGCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAGTGGCTA CTGGAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGT CAAGTACGTCTTCCGAACTGAGAATGGGGGCCAGGTGATGTACAGGGTGATCCAGGTGTCAGAGGGGCAG CTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTACCCTGCCACTCAGTCTATGACCCAGGCAG TGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATAC ATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGTACCACATCTGGGAGTACTACAGCTGTTGTT ACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTGTGATGA TGTCACCACAAGAAGTATTGCAGGGAGGGAGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCC GAAGTCAGAGGCTCCCAGGACAACTCGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAGCGCCGC CGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCA CCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATTATATCCAGGAGCTGCGGCAGAG CAACCACCGGCTGTCTGAAGAGCTGCAGGGGTTAGATCAGTTGCAGCTGGACAACGATGTGCTCCGGCAA CAGGTGGAAGATCTCAAGAACAAGAACCTGCTCCTGCGAGCTCAGCTTCGGCACCACGGACTCGAGGTCG TCATCAAGAATGACAGCAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009480 |
Insert Size | 933 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009480.3, NP_033506.1 |
RefSeq Size | 1853 bp |
RefSeq ORF | 933 bp |
Locus ID | 22278 |
UniProt ID | Q61069 |
Gene Summary | This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. The 5' terminal exon of this transcript was described in PMID:8938446, and is supported by RNASeq data. Variants 1, 2, and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the 5' terminal exon were described in PMID: 8938446. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224006 | Usf1 (tGFP-tagged) - Mouse upstream transcription factor 1 (Usf1), (10ug) |
CNY 3,420.00 |
|
MR224006 | Usf1 (Myc-DDK-tagged) - Mouse upstream transcription factor 1 (Usf1) |
CNY 2,640.00 |
|
MR224006L3 | Lenti ORF clone of Usf1 (Myc-DDK-tagged) - Mouse upstream transcription factor 1 (Usf1) |
CNY 5,040.00 |
|
MR224006L4 | Lenti ORF clone of Usf1 (mGFP-tagged) - Mouse upstream transcription factor 1 (Usf1) |
CNY 5,040.00 |