Bves (NM_024285) Mouse Untagged Clone

CAT#: MC209671

Bves (untagged) - Mouse blood vessel epicardial substance (Bves), (10ug)



  "NM_024285" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms mBVES; Pop1; Popdc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209671 representing NM_024285
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATTCCACGGAGTCCATCCCGCTGGCACAGTCAACTGTAGCAGGTTTTACATCTGAGTTAGAAAGTC
TCACACCCGTGCCTTCTAATGAGACCACTTGTGAGAACTGGCGAGAGATTCACCATCTGGTTTTTCATGT
AGCAAACGTTTGCTTTGCAGTTGGTTTGCTAATTCCCACCACTCTTCACCTCCATATGATACTGCTCAGA
GTGATGTTGTCTCTAGGATGTACCCTTTATGTGGTCTGGGCCACTCTCTACCGCTGTGCCTTGGATGTGA
TGATCTGGAACTCGGTGTTCTTGGGTATCAATATTTTGCATCTTTCATATCTTTTGTACAAGAAAAGACC
GGTCAAAATTGAAAAGGAGCTGGGTGGTGTCTACCATCGGTTGTTTGAACCACTCCGAGTCCCTCCGGAT
TTGTTTAGAAGGTTAACCGGACAGTTTTGTATGATCCAGACCTTGAAAAGGGGCCAGGTTTACGCCACAG
AGGACAAAACCTCAGTTGATGATCGTCTTAGTATTCTCCTAAAAGGAAGAATGAAGGTCTCCTATCGAGG
ACATTTTCTGCATAACATTTACCCGTGTGCCTTTATAGATTCTCCCGAATTCAGATCAACGCAGATGCAC
AAAGGCGAAAAATTCCAGGTCACCATTGTTGCAGATGATAACTGCAGGTTCTTATGCTGGTCAAGAGAAA
GACTGACTTACTTTCTGGAGTCAGAGCCTTTTCTGTATGAAATTTTTAGGTACCTTATAGGAAAAGACAT
TACAAATAAGCTGTACTCACTGAATGACCCTACTTTAAATGATAAGAAAGTTAAGAAGCTGGAGCCCCAG
ATGAGCCTCTGCACACAGATCTCCATGCTGGAGATGAGGAACAGTATCACCAGCTCCAGCGACGGCGAGG
ACGGCCTGCACCACTTTCTGCGGGGCTCCTCCAGCACGGCGTCTCTCCCCATGTCCTCCCCGCAGCAGCG
AGCCTCTGCCAAGATGAAGCCAATCGAGGAAGGGGTAGAAGATGACGATGAGGTCTTTGTGTCTCCAGAC
GCACTCAAAGTCCATCAGTTGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024285
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024285.2, NP_077247.1
RefSeq Size 1607 bp
RefSeq ORF 1077 bp
Locus ID 23828
UniProt ID Q9ES83
Gene Summary Cell adhesion molecule involved in the establishment and/or maintenance of cell integrity. Involved in the formation and regulation of the tight junction (TJ) paracellular permeability barrier in epithelial cells (PubMed:16188940). Plays a role in VAMP3-mediated vesicular transport and recycling of different receptor molecules through its interaction with VAMP3 (PubMed:20057356). Plays a role in the regulation of cell shape and movement by modulating the Rho-family GTPase activity through its interaction with ARHGEF25/GEFT (PubMed:18541910). Induces primordial adhesive contact and aggregation of epithelial cells in a Ca(2+)-independent manner. Also involved in striated muscle regeneration and repair and in the regulation of cell spreading (PubMed:11839816). Important for the maintenance of cardiac function. Plays a regulatory function in heart rate dynamics mediated, at least in part, through cAMP-binding and, probably, by increasing cell surface expression of the potassium channel KCNK2 and enhancing current density (PubMed:26642364). Is a caveolae-associated protein important for the preservation of caveolae structural and functional integrity as well as for heart protection against ischemia injury (PubMed:24066022).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...